View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18837_low_31 (Length: 240)
Name: NF18837_low_31
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18837_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 33336161 - 33335941
Alignment:
| Q |
1 |
ttttgttcatcattgcaataagttgcattcttttgtgcagcaagatcgaaagacaaaagatgataaggagaagaaaccgactatgacggctaaatatgtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33336161 |
ttttgttcatcattgcaataagttgcattcttttgtgtagcaagatcgaaaaacaaaagatgataaggagaagaaaccgactatgacggctaaatatgtc |
33336062 |
T |
|
| Q |
101 |
acaattccaccaaaaagaatgtgcaaattctagaaaactgctggatcaacataggataattgtgaggaggttcaccatgagaagggtatcgagcatgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33336061 |
acaattccaccaaaaagaatgtgcaaattctagaaaactgctggatcaacataggataattgtgaggaggttcaccatgagaagggtatcgagcatgtaa |
33335962 |
T |
|
| Q |
201 |
atcatgttgagaaggatttat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33335961 |
atcatgttgagaaggatttat |
33335941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University