View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18837_low_32 (Length: 232)

Name: NF18837_low_32
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18837_low_32
NF18837_low_32
[»] chr6 (1 HSPs)
chr6 (162-222)||(428107-428167)


Alignment Details
Target: chr6 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 162 - 222
Target Start/End: Complemental strand, 428167 - 428107
Alignment:
162 tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgatgatg 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
428167 tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgctgatg 428107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University