View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18837_low_33 (Length: 229)
Name: NF18837_low_33
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18837_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 57 - 212
Target Start/End: Original strand, 26491226 - 26491378
Alignment:
| Q |
57 |
aaggagcaatccattgtatgcagatttggataaggcagttcctaatgagcataagaaatttcttgcaaatttggtttgggttcatgaagaggtggtgctt |
156 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26491226 |
aaggagcaatcctttgtacgcagatttggataaggcagttcctgatgagcataagaaatttcttgcaaatttggtttgggttcatgaagaggtggtgc-- |
26491323 |
T |
 |
| Q |
157 |
aattactttatttgcctctttgtttctatactc-atatcaaacagtccttgttttat |
212 |
Q |
| |
|
||||||| |||||| |||||||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
26491324 |
--ttactttctttgccgctttgtttctatgctctatatcaaaccatccttgttttat |
26491378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 16 - 89
Target Start/End: Original strand, 26500319 - 26500392
Alignment:
| Q |
16 |
atgtatatggattgttgcatacataattatgacactctctaaaggagcaatccattgtatgcagatttggataa |
89 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26500319 |
atgtatatggattgttgcatacataactatgacactctctaaaggagcaatccattgtatgcagatttggataa |
26500392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 57 - 198
Target Start/End: Original strand, 26503663 - 26503800
Alignment:
| Q |
57 |
aaggagcaatccattgtatgcagatttggataaggcagttcctaatgagcataagaaatttcttgcaaatttggtttgggttcatgaagaggtggtgctt |
156 |
Q |
| |
|
|||||||| | ||||| |||||||||||| ||||||||||||| ||||||||||||||||||| || |||||||||||||| ||||||||||| ||| |
|
|
| T |
26503663 |
aaggagcagttcattgcatgcagatttggttaaggcagttcctgatgagcataagaaatttctcgcgaatttggtttgggtgcatgaagaggtagtg--- |
26503759 |
T |
 |
| Q |
157 |
aattactttatttgcctctttgtttctatactcatatcaaac |
198 |
Q |
| |
|
||||||| ||||||||||| |||| ||| ||||||||||| |
|
|
| T |
26503760 |
-tttactttctttgcctctttctttcaatagtcatatcaaac |
26503800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 112 - 209
Target Start/End: Original strand, 26487961 - 26488054
Alignment:
| Q |
112 |
aaatttcttgcaaatttggtttgggttcatgaagaggtggtgcttaattactttatttgcctctttgtttctatactcatatcaaacagtccttgttt |
209 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
26487961 |
aaatttctcgcaaatttggtttgggttcatgaagaggtggtgc----ttactttctttgcctctttgtttctatactcttatcaaacaatccttgttt |
26488054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University