View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18837_low_9 (Length: 408)
Name: NF18837_low_9
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18837_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 15 - 321
Target Start/End: Complemental strand, 55068050 - 55067744
Alignment:
| Q |
15 |
aataaccaccgcacaacagcaacagcaactgcaactatatttcagactcagagactcacaggaaatgcttcaagaataacgataaagtgtatggctaatc |
114 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55068050 |
aataatcaccgcacagcagcaactgcaactgtaactatatttcagactcagagactcacaggaaatgcttcaagaataacgataaagtgtatggctaatc |
55067951 |
T |
 |
| Q |
115 |
caaggagagtcaaaatggttgccaaacaaattaggagagaactttctgatatgctcatcaccgataacgtcttgcaatttgccgttcttccagaagcttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55067950 |
caaggagagtcaaaatggttgccaaacaaattaggagagaactttctgatatgctcatcaccgataacgtcttgcaatttgccgttcttccagaagcttc |
55067851 |
T |
 |
| Q |
215 |
cttaggtgctgatttatatctctcttccgtaaccactatcaccgacgttgaaatcaccgctgatttacaggttcgttcatacacactctcttcttttttc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55067850 |
cttaggtgctgatttatatctctcttccgtaaccactattaccgacgttgaaatcaccgctgatttacaggttcgttcatacatactctcttcttttttc |
55067751 |
T |
 |
| Q |
315 |
ctattta |
321 |
Q |
| |
|
||||||| |
|
|
| T |
55067750 |
ctattta |
55067744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 348 - 405
Target Start/End: Complemental strand, 55067735 - 55067678
Alignment:
| Q |
348 |
ttattattatcatattaaattcatagacctgaatttaattgccacattgccttttcat |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55067735 |
ttattattatcatattaaattcatagacctgaatttaattgccacattgccttttcat |
55067678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University