View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18839_high_19 (Length: 243)

Name: NF18839_high_19
Description: NF18839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18839_high_19
NF18839_high_19
[»] chr2 (2 HSPs)
chr2 (38-208)||(29136519-29136687)
chr2 (171-211)||(3677305-3677345)


Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 38 - 208
Target Start/End: Complemental strand, 29136687 - 29136519
Alignment:
38 ataagcaaacactgaatattgcaaaaccgataaatagagacaaacgatgaatattttttccaaataaatccgctagaattggtaaaactcactcgtccaa 137  Q
    ||||||||||| ||||||||| ||  | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29136687 ataagcaaacaatgaatattgtaa--ctgataaatagagacaaacaatgaatattttttccaaataaatccgctagaattggtaaaactcactcgtccaa 29136590  T
138 aatatgtcattttagtcaatttgtggagtagtgttttattttaaagaagataaattaactcacttaaattg 208  Q
    |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||    
29136589 aatatgtcattttagtcaatctgtagagtagtgttttattttaaagaagataaattaactcacttaaattg 29136519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 211
Target Start/End: Original strand, 3677305 - 3677345
Alignment:
171 ttttattttaaagaagataaattaactcacttaaattgata 211  Q
    |||| |||| |||||| ||||||||||||||||||||||||    
3677305 ttttttttttaagaagctaaattaactcacttaaattgata 3677345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University