View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18839_high_19 (Length: 243)
Name: NF18839_high_19
Description: NF18839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18839_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 38 - 208
Target Start/End: Complemental strand, 29136687 - 29136519
Alignment:
| Q |
38 |
ataagcaaacactgaatattgcaaaaccgataaatagagacaaacgatgaatattttttccaaataaatccgctagaattggtaaaactcactcgtccaa |
137 |
Q |
| |
|
||||||||||| ||||||||| || | ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29136687 |
ataagcaaacaatgaatattgtaa--ctgataaatagagacaaacaatgaatattttttccaaataaatccgctagaattggtaaaactcactcgtccaa |
29136590 |
T |
|
| Q |
138 |
aatatgtcattttagtcaatttgtggagtagtgttttattttaaagaagataaattaactcacttaaattg |
208 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29136589 |
aatatgtcattttagtcaatctgtagagtagtgttttattttaaagaagataaattaactcacttaaattg |
29136519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 211
Target Start/End: Original strand, 3677305 - 3677345
Alignment:
| Q |
171 |
ttttattttaaagaagataaattaactcacttaaattgata |
211 |
Q |
| |
|
|||| |||| |||||| |||||||||||||||||||||||| |
|
|
| T |
3677305 |
ttttttttttaagaagctaaattaactcacttaaattgata |
3677345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University