View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18839_low_11 (Length: 389)

Name: NF18839_low_11
Description: NF18839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18839_low_11
NF18839_low_11
[»] chr1 (65 HSPs)
chr1 (156-316)||(12744310-12744471)
chr1 (156-316)||(12755300-12755461)
chr1 (12-123)||(12744521-12744632)
chr1 (12-123)||(12755511-12755622)
chr1 (311-372)||(12744194-12744255)
chr1 (311-372)||(12755184-12755245)
chr1 (22-122)||(32142845-32142945)
chr1 (22-86)||(48798105-48798169)
chr1 (34-104)||(21849222-21849292)
chr1 (22-83)||(10336525-10336586)
chr1 (22-123)||(34697344-34697445)
chr1 (22-110)||(30927738-30927826)
chr1 (7-122)||(32150921-32151036)
chr1 (22-87)||(14254302-14254367)
chr1 (22-122)||(5855531-5855631)
chr1 (31-123)||(8764009-8764101)
chr1 (30-110)||(16956483-16956563)
chr1 (22-122)||(50503360-50503460)
chr1 (12-87)||(5504030-5504105)
chr1 (22-69)||(18649404-18649451)
chr1 (34-87)||(9659213-9659266)
chr1 (22-123)||(17642002-17642103)
chr1 (22-103)||(18915876-18915957)
chr1 (22-87)||(33498873-33498938)
chr1 (31-88)||(43959854-43959911)
chr1 (22-123)||(49078123-49078224)
chr1 (35-123)||(34719798-34719886)
chr1 (22-110)||(45361893-45361981)
chr1 (32-87)||(38791644-38791699)
chr1 (22-92)||(18708569-18708639)
chr1 (20-86)||(33004050-33004116)
chr1 (37-110)||(10172982-10173055)
chr1 (22-87)||(10422797-10422862)
chr1 (22-87)||(16263554-16263619)
chr1 (22-123)||(26325821-26325922)
chr1 (22-123)||(41663854-41663955)
chr1 (22-87)||(42710172-42710237)
chr1 (31-87)||(32889-32945)
chr1 (22-110)||(15465974-15466062)
chr1 (22-110)||(17358482-17358570)
chr1 (22-110)||(26660147-26660234)
chr1 (20-87)||(35908764-35908832)
chr1 (22-110)||(40288488-40288576)
chr1 (20-87)||(17389779-17389845)
chr1 (33-103)||(37339840-37339910)
chr1 (22-87)||(17092511-17092576)
chr1 (52-92)||(28324609-28324649)
chr1 (207-254)||(17350113-17350160)
chr1 (32-87)||(33418149-33418204)
chr1 (207-254)||(39238768-39238815)
chr1 (207-254)||(52833102-52833149)
chr1 (207-253)||(7438673-7438719)
chr1 (56-110)||(35211183-35211237)
chr1 (37-87)||(44969688-44969738)
chr1 (22-88)||(50371867-50371933)
chr1 (32-77)||(12036788-12036833)
chr1 (30-83)||(18808282-18808335)
chr1 (38-79)||(19195391-19195432)
chr1 (206-251)||(38021303-38021348)
chr1 (34-87)||(47312933-47312986)
chr1 (34-87)||(50094925-50094978)
chr1 (31-87)||(10507716-10507772)
chr1 (207-251)||(23368731-23368775)
chr1 (207-243)||(29491522-29491558)
chr1 (201-253)||(29936678-29936730)
[»] chr8 (44 HSPs)
chr8 (22-122)||(8141114-8141214)
chr8 (20-110)||(43032911-43033001)
chr8 (22-87)||(18374022-18374087)
chr8 (36-123)||(10927632-10927719)
chr8 (22-88)||(33401831-33401897)
chr8 (34-110)||(45521192-45521268)
chr8 (22-104)||(16291219-16291301)
chr8 (35-88)||(583837-583890)
chr8 (34-110)||(4479306-4479382)
chr8 (27-123)||(11298264-11298360)
chr8 (34-110)||(15884566-15884642)
chr8 (22-92)||(1013005-1013075)
chr8 (22-92)||(6100484-6100554)
chr8 (34-92)||(10535432-10535490)
chr8 (22-87)||(2467151-2467216)
chr8 (34-106)||(6042845-6042917)
chr8 (35-91)||(28333062-28333118)
chr8 (36-123)||(2964102-2964189)
chr8 (31-78)||(8586981-8587028)
chr8 (22-85)||(17981453-17981516)
chr8 (32-86)||(3567926-3567980)
chr8 (22-104)||(14666087-14666169)
chr8 (38-88)||(18091428-18091478)
chr8 (32-110)||(44893288-44893366)
chr8 (22-87)||(43027317-43027382)
chr8 (22-110)||(3418523-3418611)
chr8 (32-92)||(33935763-33935823)
chr8 (207-258)||(2696585-2696636)
chr8 (207-254)||(2800071-2800118)
chr8 (27-101)||(22212534-22212609)
chr8 (32-87)||(26570946-26571001)
chr8 (36-123)||(27975917-27976004)
chr8 (36-123)||(28033186-28033273)
chr8 (207-254)||(35301159-35301206)
chr8 (32-78)||(7673699-7673745)
chr8 (21-87)||(22958781-22958847)
chr8 (22-88)||(29933784-29933850)
chr8 (22-87)||(9860028-9860093)
chr8 (216-261)||(10310343-10310388)
chr8 (208-261)||(36815453-36815505)
chr8 (52-92)||(3692875-3692915)
chr8 (22-86)||(6940570-6940633)
chr8 (34-78)||(28537433-28537477)
chr8 (207-251)||(31129354-31129398)
[»] scaffold0170 (1 HSPs)
scaffold0170 (20-110)||(9854-9944)
[»] chr5 (61 HSPs)
chr5 (22-123)||(9805013-9805114)
chr5 (22-123)||(42086336-42086437)
chr5 (22-87)||(14588650-14588715)
chr5 (21-101)||(40117423-40117503)
chr5 (24-111)||(32874798-32874885)
chr5 (22-87)||(12081917-12081982)
chr5 (22-110)||(4016265-4016353)
chr5 (31-103)||(19572742-19572814)
chr5 (36-123)||(12705037-12705124)
chr5 (20-123)||(13664267-13664370)
chr5 (20-110)||(14728089-14728180)
chr5 (31-110)||(39099789-39099868)
chr5 (22-92)||(7308392-7308462)
chr5 (26-88)||(18262650-18262712)
chr5 (22-123)||(1538440-1538541)
chr5 (22-110)||(23383666-23383754)
chr5 (22-110)||(25417193-25417281)
chr5 (36-123)||(9812895-9812982)
chr5 (12-83)||(20682654-20682725)
chr5 (22-101)||(21149743-21149822)
chr5 (22-109)||(35561829-35561916)
chr5 (22-88)||(11845833-11845899)
chr5 (22-123)||(5731917-5732018)
chr5 (22-123)||(12766140-12766241)
chr5 (22-91)||(30995130-30995199)
chr5 (22-87)||(41800986-41801051)
chr5 (12-76)||(25467409-25467473)
chr5 (22-78)||(28857137-28857193)
chr5 (34-110)||(38897729-38897805)
chr5 (27-87)||(43399142-43399202)
chr5 (207-258)||(4674807-4674858)
chr5 (36-87)||(9168286-9168337)
chr5 (34-85)||(20590020-20590071)
chr5 (207-258)||(36045126-36045177)
chr5 (37-87)||(3653947-3653997)
chr5 (36-110)||(7866604-7866678)
chr5 (37-87)||(20255393-20255443)
chr5 (22-88)||(24463918-24463984)
chr5 (22-87)||(20525847-20525912)
chr5 (61-110)||(28857194-28857243)
chr5 (34-87)||(37263261-37263314)
chr5 (53-121)||(2485236-2485304)
chr5 (20-68)||(19839334-19839382)
chr5 (22-66)||(21487626-21487670)
chr5 (12-92)||(28862824-28862904)
chr5 (31-87)||(42291538-42291594)
chr5 (207-254)||(1463923-1463970)
chr5 (12-91)||(26077140-26077219)
chr5 (32-87)||(30349598-30349653)
chr5 (26-77)||(35245049-35245100)
chr5 (50-88)||(6764489-6764527)
chr5 (34-88)||(25452946-25453000)
chr5 (22-92)||(39728396-39728466)
chr5 (38-104)||(42861234-42861300)
chr5 (34-87)||(14974357-14974410)
chr5 (25-101)||(5079343-5079419)
chr5 (13-61)||(20516460-20516508)
chr5 (20-72)||(20705570-20705622)
chr5 (35-87)||(21375373-21375425)
chr5 (22-122)||(24653810-24653909)
chr5 (66-110)||(28857002-28857046)
[»] scaffold0291 (1 HSPs)
scaffold0291 (22-110)||(6866-6954)
[»] chr7 (56 HSPs)
chr7 (22-110)||(38578877-38578965)
chr7 (31-110)||(13095878-13095957)
chr7 (22-110)||(27028290-27028378)
chr7 (22-88)||(34659237-34659303)
chr7 (22-123)||(5069812-5069913)
chr7 (22-123)||(22973978-22974079)
chr7 (36-123)||(22993364-22993451)
chr7 (22-123)||(1605952-1606053)
chr7 (22-123)||(10047873-10047974)
chr7 (22-103)||(14650328-14650409)
chr7 (22-123)||(17748379-17748480)
chr7 (22-122)||(4195200-4195300)
chr7 (20-104)||(16802132-16802216)
chr7 (22-110)||(23658190-23658278)
chr7 (22-110)||(36619264-36619352)
chr7 (22-86)||(43862006-43862070)
chr7 (34-110)||(48804706-48804782)
chr7 (31-110)||(21530768-21530847)
chr7 (207-254)||(24304279-24304326)
chr7 (30-87)||(28396193-28396250)
chr7 (22-87)||(30827303-30827368)
chr7 (38-123)||(42210259-42210344)
chr7 (26-110)||(14535306-14535390)
chr7 (35-87)||(39420861-39420913)
chr7 (12-75)||(45697235-45697297)
chr7 (22-109)||(47341887-47341974)
chr7 (34-101)||(48244375-48244442)
chr7 (32-110)||(18785690-18785768)
chr7 (207-253)||(28914874-28914920)
chr7 (52-109)||(3603398-3603455)
chr7 (207-256)||(19126789-19126838)
chr7 (22-83)||(22573824-22573884)
chr7 (34-87)||(39474963-39475016)
chr7 (52-104)||(24983435-24983487)
chr7 (22-110)||(37514932-37515020)
chr7 (35-87)||(41945497-41945549)
chr7 (34-110)||(43346789-43346865)
chr7 (52-92)||(45960031-45960071)
chr7 (22-77)||(365151-365206)
chr7 (20-87)||(27875121-27875188)
chr7 (22-85)||(43925523-43925586)
chr7 (12-110)||(8734696-8734794)
chr7 (207-277)||(31475813-31475883)
chr7 (22-75)||(41267969-41268023)
chr7 (22-68)||(45447981-45448027)
chr7 (22-87)||(1797471-1797536)
chr7 (52-101)||(5039437-5039486)
chr7 (36-77)||(19914746-19914787)
chr7 (207-236)||(35368448-35368477)
chr7 (36-85)||(39230524-39230573)
chr7 (199-236)||(48258198-48258235)
chr7 (32-85)||(49142704-49142757)
chr7 (36-88)||(4228786-4228838)
chr7 (40-88)||(21190812-21190860)
chr7 (201-233)||(38854025-38854057)
chr7 (52-104)||(38988941-38988993)
[»] chr6 (42 HSPs)
chr6 (22-110)||(13036014-13036102)
chr6 (31-123)||(12635835-12635927)
chr6 (19-88)||(12606439-12606508)
chr6 (22-123)||(14107355-14107456)
chr6 (22-123)||(21898660-21898761)
chr6 (22-110)||(5253233-5253321)
chr6 (22-122)||(30410457-30410557)
chr6 (36-123)||(8611971-8612058)
chr6 (22-85)||(29444800-29444863)
chr6 (37-123)||(9633622-9633708)
chr6 (22-123)||(6606094-6606195)
chr6 (22-83)||(8932673-8932734)
chr6 (22-83)||(8944139-8944200)
chr6 (22-110)||(3601096-3601184)
chr6 (12-84)||(9366459-9366531)
chr6 (31-77)||(31129198-31129244)
chr6 (22-87)||(8938723-8938788)
chr6 (34-87)||(29333172-29333225)
chr6 (20-88)||(13391297-13391364)
chr6 (36-123)||(30788850-30788937)
chr6 (22-72)||(33859367-33859417)
chr6 (22-87)||(9147313-9147378)
chr6 (50-123)||(14783417-14783490)
chr6 (22-87)||(34954652-34954717)
chr6 (31-87)||(19089519-19089575)
chr6 (26-86)||(32157201-32157261)
chr6 (58-109)||(14326045-14326096)
chr6 (58-109)||(14419055-14419106)
chr6 (207-261)||(15126294-15126348)
chr6 (207-254)||(29284170-29284217)
chr6 (207-254)||(33628937-33628984)
chr6 (22-88)||(5029829-5029895)
chr6 (207-253)||(5641687-5641733)
chr6 (21-87)||(8888893-8888959)
chr6 (34-104)||(10311485-10311555)
chr6 (207-237)||(23771085-23771115)
chr6 (37-110)||(2271313-2271386)
chr6 (34-87)||(3587978-3588031)
chr6 (22-87)||(9179769-9179834)
chr6 (38-75)||(11142631-11142668)
chr6 (36-88)||(17114929-17114981)
chr6 (201-253)||(17217004-17217056)
[»] chr2 (70 HSPs)
chr2 (22-110)||(38962771-38962859)
chr2 (19-104)||(6358167-6358252)
chr2 (22-123)||(12455318-12455419)
chr2 (22-123)||(41220643-41220744)
chr2 (22-110)||(10026626-10026714)
chr2 (22-123)||(8410139-8410240)
chr2 (21-110)||(39201518-39201607)
chr2 (32-122)||(11069896-11069986)
chr2 (22-88)||(15079491-15079557)
chr2 (22-92)||(16034945-16035015)
chr2 (32-110)||(25540414-25540492)
chr2 (22-103)||(331509-331590)
chr2 (54-123)||(3811688-3811757)
chr2 (22-123)||(13026408-13026509)
chr2 (22-87)||(14169642-14169707)
chr2 (34-123)||(38005422-38005511)
chr2 (38-91)||(41187873-41187926)
chr2 (22-110)||(10046487-10046574)
chr2 (31-123)||(10823077-10823169)
chr2 (20-88)||(29653633-29653701)
chr2 (22-110)||(44139492-44139580)
chr2 (12-71)||(15234110-15234169)
chr2 (52-103)||(18649043-18649094)
chr2 (20-110)||(12864230-12864320)
chr2 (22-104)||(22593143-22593224)
chr2 (25-123)||(34346284-34346382)
chr2 (22-104)||(45263683-45263765)
chr2 (22-103)||(2550876-2550957)
chr2 (22-110)||(16325603-16325691)
chr2 (34-110)||(18902540-18902616)
chr2 (22-110)||(28616389-28616477)
chr2 (22-110)||(41031916-41032004)
chr2 (36-88)||(44945615-44945667)
chr2 (36-87)||(3643920-3643971)
chr2 (36-123)||(7747296-7747383)
chr2 (34-121)||(33005771-33005858)
chr2 (20-75)||(37804936-37804991)
chr2 (22-88)||(7787064-7787130)
chr2 (38-88)||(9360780-9360830)
chr2 (37-87)||(13104858-13104908)
chr2 (22-88)||(19976839-19976905)
chr2 (30-104)||(42770667-42770741)
chr2 (22-76)||(43303336-43303390)
chr2 (22-91)||(2528370-2528439)
chr2 (38-91)||(21286468-21286521)
chr2 (34-87)||(24179588-24179641)
chr2 (25-110)||(27725951-27726036)
chr2 (22-86)||(28525489-28525554)
chr2 (22-83)||(34356214-34356275)
chr2 (22-123)||(34722688-34722789)
chr2 (34-110)||(35946758-35946834)
chr2 (207-258)||(2304342-2304393)
chr2 (31-110)||(10669609-10669688)
chr2 (207-254)||(29035028-29035075)
chr2 (35-74)||(30929370-30929409)
chr2 (207-254)||(34034402-34034449)
chr2 (22-110)||(20612544-20612634)
chr2 (20-90)||(21180344-21180414)
chr2 (54-88)||(21641990-21642024)
chr2 (22-88)||(41187717-41187783)
chr2 (34-87)||(16813198-16813251)
chr2 (34-87)||(16852477-16852530)
chr2 (24-101)||(26805306-26805383)
chr2 (34-87)||(29421302-29421355)
chr2 (22-83)||(37560181-37560242)
chr2 (206-250)||(44422158-44422203)
chr2 (36-84)||(20116648-20116696)
chr2 (190-242)||(23903007-23903058)
chr2 (11-83)||(31596469-31596541)
chr2 (207-278)||(31657946-31658017)
[»] chr3 (72 HSPs)
chr3 (22-121)||(35315964-35316063)
chr3 (22-123)||(26043820-26043921)
chr3 (22-123)||(29127927-29128028)
chr3 (34-121)||(47471851-47471938)
chr3 (34-123)||(47749103-47749192)
chr3 (22-110)||(24506659-24506746)
chr3 (22-110)||(30767258-30767346)
chr3 (19-86)||(928605-928672)
chr3 (35-110)||(3507544-3507619)
chr3 (33-92)||(42412803-42412862)
chr3 (20-86)||(29135919-29135985)
chr3 (32-110)||(49198369-49198447)
chr3 (32-110)||(50405614-50405692)
chr3 (36-110)||(54261248-54261322)
chr3 (22-87)||(6462420-6462485)
chr3 (27-88)||(7648753-7648814)
chr3 (38-87)||(47219168-47219217)
chr3 (34-110)||(41630523-41630599)
chr3 (38-110)||(43330743-43330815)
chr3 (22-110)||(45877462-45877550)
chr3 (22-110)||(51682965-51683053)
chr3 (21-88)||(2029300-2029367)
chr3 (25-88)||(10855395-10855458)
chr3 (32-87)||(48342038-48342093)
chr3 (22-104)||(7328852-7328933)
chr3 (22-108)||(40944891-40944976)
chr3 (22-87)||(3755578-3755643)
chr3 (22-123)||(7310701-7310802)
chr3 (22-123)||(15320194-15320295)
chr3 (34-87)||(26207835-26207888)
chr3 (22-123)||(28572209-28572310)
chr3 (22-123)||(51060279-51060380)
chr3 (36-88)||(39849093-39849145)
chr3 (54-110)||(44064584-44064640)
chr3 (22-110)||(49543527-49543615)
chr3 (20-87)||(3136728-3136794)
chr3 (36-87)||(22909805-22909856)
chr3 (207-258)||(24559441-24559492)
chr3 (52-123)||(49021201-49021272)
chr3 (35-110)||(55069690-55069765)
chr3 (34-88)||(15795527-15795581)
chr3 (24-110)||(29762166-29762252)
chr3 (53-123)||(45402349-45402419)
chr3 (22-92)||(53649735-53649805)
chr3 (22-103)||(7650235-7650316)
chr3 (13-85)||(4638153-4638225)
chr3 (34-78)||(10040576-10040620)
chr3 (25-101)||(13893937-13894013)
chr3 (8-68)||(26590319-26590379)
chr3 (44-88)||(28538221-28538265)
chr3 (32-88)||(32873582-32873638)
chr3 (35-87)||(33251683-33251735)
chr3 (36-76)||(52364845-52364885)
chr3 (23-87)||(54237457-54237521)
chr3 (34-101)||(8164573-8164640)
chr3 (207-254)||(9625035-9625082)
chr3 (207-254)||(10959185-10959232)
chr3 (19-110)||(19146966-19147057)
chr3 (207-254)||(27183677-27183724)
chr3 (32-87)||(35923657-35923712)
chr3 (38-92)||(2668085-2668139)
chr3 (25-75)||(11687155-11687205)
chr3 (33-87)||(25294979-25295033)
chr3 (34-72)||(45450496-45450534)
chr3 (38-87)||(8362601-8362650)
chr3 (34-75)||(23511587-23511628)
chr3 (22-71)||(31072886-31072935)
chr3 (22-87)||(34662353-34662418)
chr3 (38-83)||(37319927-37319972)
chr3 (34-86)||(13367444-13367496)
chr3 (207-251)||(16141352-16141396)
chr3 (34-110)||(26361978-26362054)
[»] scaffold0010 (1 HSPs)
scaffold0010 (22-104)||(155727-155809)
[»] chr4 (74 HSPs)
chr4 (22-110)||(3159479-3159567)
chr4 (22-122)||(38075446-38075546)
chr4 (22-110)||(47078471-47078559)
chr4 (35-110)||(7246656-7246731)
chr4 (12-110)||(30317236-30317334)
chr4 (22-110)||(40780871-40780959)
chr4 (25-104)||(5472864-5472943)
chr4 (22-101)||(20532428-20532507)
chr4 (31-110)||(38166049-38166128)
chr4 (34-88)||(17080068-17080122)
chr4 (25-87)||(20354653-20354715)
chr4 (22-87)||(1446839-1446904)
chr4 (22-123)||(4738631-4738732)
chr4 (10-87)||(16450301-16450378)
chr4 (22-87)||(29895800-29895865)
chr4 (52-121)||(31588729-31588798)
chr4 (22-123)||(35359749-35359850)
chr4 (31-92)||(42722605-42722666)
chr4 (35-123)||(36262764-36262852)
chr4 (22-110)||(40272341-40272429)
chr4 (7-103)||(48317292-48317388)
chr4 (22-110)||(55921047-55921135)
chr4 (22-77)||(20421786-20421841)
chr4 (34-109)||(49260676-49260751)
chr4 (34-87)||(8064831-8064884)
chr4 (22-103)||(14124029-14124110)
chr4 (22-123)||(20128322-20128423)
chr4 (22-87)||(36145248-36145313)
chr4 (22-104)||(1940793-1940872)
chr4 (11-87)||(2686488-2686564)
chr4 (34-110)||(46108716-46108792)
chr4 (198-254)||(46799450-46799506)
chr4 (22-122)||(52950095-52950195)
chr4 (22-85)||(29588749-29588812)
chr4 (207-254)||(36954189-36954236)
chr4 (207-258)||(52330901-52330952)
chr4 (20-110)||(2559318-2559408)
chr4 (32-110)||(8889045-8889123)
chr4 (22-88)||(12703577-12703643)
chr4 (20-86)||(14859302-14859368)
chr4 (34-76)||(24850671-24850713)
chr4 (22-88)||(43468360-43468426)
chr4 (22-92)||(53599073-53599143)
chr4 (31-92)||(3574474-3574535)
chr4 (22-87)||(6779224-6779289)
chr4 (52-109)||(14567282-14567339)
chr4 (35-87)||(3507296-3507348)
chr4 (52-88)||(15839967-15840003)
chr4 (22-110)||(16645131-16645219)
chr4 (36-92)||(38168284-38168339)
chr4 (207-254)||(8690266-8690313)
chr4 (207-254)||(9693014-9693061)
chr4 (22-77)||(10541029-10541084)
chr4 (207-254)||(14149845-14149892)
chr4 (207-254)||(28520727-28520774)
chr4 (20-87)||(43458624-43458691)
chr4 (22-85)||(48015108-48015171)
chr4 (207-254)||(48968206-48968253)
chr4 (13-88)||(49952178-49952253)
chr4 (21-88)||(55005338-55005405)
chr4 (208-242)||(11084260-11084294)
chr4 (207-253)||(22096388-22096434)
chr4 (207-261)||(40150525-40150579)
chr4 (22-88)||(41162914-41162980)
chr4 (56-110)||(54946296-54946350)
chr4 (57-110)||(4736645-4736698)
chr4 (42-87)||(6032676-6032721)
chr4 (25-86)||(15829715-15829776)
chr4 (22-71)||(21429314-21429363)
chr4 (34-83)||(26479986-26480035)
chr4 (22-71)||(33647734-33647783)
chr4 (19-75)||(17946500-17946555)
chr4 (190-242)||(21365511-21365562)
chr4 (31-110)||(27248450-27248527)
[»] scaffold0316 (1 HSPs)
scaffold0316 (22-104)||(1630-1712)
[»] scaffold0209 (1 HSPs)
scaffold0209 (35-88)||(12597-12650)
[»] scaffold0086 (1 HSPs)
scaffold0086 (22-87)||(26194-26259)
[»] scaffold0384 (1 HSPs)
scaffold0384 (22-110)||(5984-6071)
[»] scaffold0016 (1 HSPs)
scaffold0016 (22-110)||(8711-8799)
[»] scaffold0002 (2 HSPs)
scaffold0002 (22-110)||(581-669)
scaffold0002 (32-87)||(319443-319498)
[»] scaffold0155 (1 HSPs)
scaffold0155 (32-87)||(19276-19331)
[»] scaffold0001 (1 HSPs)
scaffold0001 (34-93)||(65179-65238)
[»] scaffold0050 (1 HSPs)
scaffold0050 (22-88)||(72643-72709)
[»] scaffold0024 (1 HSPs)
scaffold0024 (22-110)||(149396-149484)
[»] scaffold0006 (1 HSPs)
scaffold0006 (22-104)||(68528-68607)
[»] scaffold0308 (1 HSPs)
scaffold0308 (207-254)||(7128-7175)
[»] scaffold0376 (1 HSPs)
scaffold0376 (36-110)||(12695-12769)
[»] scaffold0116 (1 HSPs)
scaffold0116 (20-110)||(17399-17489)
[»] scaffold0009 (1 HSPs)
scaffold0009 (52-110)||(42842-42900)
[»] scaffold0004 (2 HSPs)
scaffold0004 (38-88)||(95013-95063)
scaffold0004 (34-110)||(7845-7921)
[»] scaffold0223 (1 HSPs)
scaffold0223 (12-121)||(16880-16989)
[»] scaffold0005 (2 HSPs)
scaffold0005 (52-109)||(250036-250093)
scaffold0005 (22-88)||(271106-271172)
[»] scaffold0029 (1 HSPs)
scaffold0029 (22-88)||(41055-41121)
[»] scaffold0372 (1 HSPs)
scaffold0372 (190-242)||(10035-10086)


Alignment Details
Target: chr1 (Bit Score: 134; Significance: 1e-69; HSPs: 65)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 156 - 316
Target Start/End: Complemental strand, 12744471 - 12744310
Alignment:
156 taatatatagattagttgttaggaacattgcataatatatagagagtcgaagttcgaactccggacaccccatttattcactttaaaggtaaatttctaa 255  Q
    ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||    
12744471 taatatatagattagttgttaggaacattgcataaaatatagagggtcgaagttcgaactccgaacaccccatttattcactttaaagataaatttctaa 12744372  T
256 ccattatattacttaaca-aaaagtaaacataggaaaatataagtgaaaaaatttgtttgat 316  Q
    |||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||    
12744371 ccattatattacttaacaaaaaaataaacataggaaaatataagtgaaaaaatttgtttgat 12744310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 156 - 316
Target Start/End: Complemental strand, 12755461 - 12755300
Alignment:
156 taatatatagattagttgttaggaacattgcataatatatagagagtcgaagttcgaactccggacaccccatttattcactttaaaggtaaatttctaa 255  Q
    ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||    
12755461 taatatatagattagttgttaggaacattgcataaaatatagagggtcgaagttcgaactccgaacaccccatttattcactttaaagataaatttctaa 12755362  T
256 ccattatattacttaaca-aaaagtaaacataggaaaatataagtgaaaaaatttgtttgat 316  Q
    |||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||    
12755361 ccattatattacttaacaaaaaaataaacataggaaaatataagtgaaaaaatttgtttgat 12755300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 12 - 123
Target Start/End: Complemental strand, 12744632 - 12744521
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaaca 111  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
12744632 gaatatcagattcgattttcagggggaacaacgcttgactagtgcgcatgtctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaaca 12744533  T
112 gaagcgaaagcc 123  Q
    || |||||||||    
12744532 gatgcgaaagcc 12744521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 12 - 123
Target Start/End: Complemental strand, 12755622 - 12755511
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaaca 111  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
12755622 gaatatcagattcgattttcagggggaacaacgcttgactagtgcgcatgtctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaaca 12755523  T
112 gaagcgaaagcc 123  Q
    || |||||||||    
12755522 gatgcgaaagcc 12755511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 311 - 372
Target Start/End: Complemental strand, 12744255 - 12744194
Alignment:
311 tttgatacaatttttaaaacattgtataaaacaccctagttgataaggaaaatgatagtgtt 372  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12744255 tttgatacaatttttaaaacattgtataaaacaccctagttgataaggaaaatgatagtgtt 12744194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 311 - 372
Target Start/End: Complemental strand, 12755245 - 12755184
Alignment:
311 tttgatacaatttttaaaacattgtataaaacaccctagttgataaggaaaatgatagtgtt 372  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12755245 tttgatacaatttttaaaacattgtataaaacaccctagttgataaggaaaatgatagtgtt 12755184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 22 - 122
Target Start/End: Complemental strand, 32142945 - 32142845
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||||||||||||||||| |||| | ||||||||||||| |||||||||||||||||||||||||||  ||| |||||| ||||| || |||||||    
32142945 ttcgattttcagggggaacaacacttggccagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcggaaaccgatgcgaaag 32142846  T
122 c 122  Q
    |    
32142845 c 32142845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 22 - 86
Target Start/End: Complemental strand, 48798169 - 48798105
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
48798169 ttcgatttccagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccggattagtc 48798105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 21849292 - 21849222
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    ||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||| ||||||||||    
21849292 ggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgctcactattggtgggtc 21849222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 22 - 83
Target Start/End: Original strand, 10336525 - 10336586
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaatta 83  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||    
10336525 ttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggatta 10336586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 34697344 - 34697445
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||| | |||||||||||| |||| |||||| |||||||||||||||||||||| ||||||||| |||| ||| |||||  ||||| || |||||||    
34697344 ttcgattcttagggggaacaacacttggctagtgtgcatgcctctacgcatgagccggattagtcgcccacttttgatgggttggaaaccgatgcgaaag 34697443  T
122 cc 123  Q
    ||    
34697444 cc 34697445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 30927826 - 30927738
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||| ||| |||||||||||||| | | || |||||||||||||||||||||| ||||||||  |||| ||||||||||||||||    
30927826 ttcgatttccagagggaacaacgcttggccaatgtgcatgcctctacgcatgagccggattagtcgtccacttttggtgggtcagaaac 30927738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 7 - 122
Target Start/End: Complemental strand, 32151036 - 32150921
Alignment:
7 tcgaagaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcag 106  Q
    |||| |||||| || |||||||| |||||||||||||  |||   ||||||||||||| |||||||||||||||||||||||||||  ||| ||||||      
32151036 tcgaggaatatcaggttcgatttccagggggaacaacatttggtcagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcga 32150937  T
107 aaacagaagcgaaagc 122  Q
    |||| || ||||||||    
32150936 aaaccgatgcgaaagc 32150921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 14254367 - 14254302
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||||||||||||||| | ||| ||||||||| ||||||||||||| ||||||||    
14254367 ttcgattttcagggggaacaacgcttggccagtacgcatgcctttacgcatgagccggattagtcg 14254302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 22 - 122
Target Start/End: Original strand, 5855531 - 5855631
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  |||| ||||||||||||| | |||||||||||||||||||||||| || |||||||| ||||  || ||||||| ||||| || |||||||    
5855531 ttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaggcggattagtcgttcacctttagtgggtcggaaaccgatgcgaaag 5855630  T
122 c 122  Q
    |    
5855631 c 5855631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 31 - 123
Target Start/End: Original strand, 8764009 - 8764101
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||||||| |||| | |||||||||||||||||||| |||||| ||||||||  ||| ||||||||||| ||||| |  |||||||||    
8764009 cagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccaccgttggtgggtcggaaaccggtgcgaaagcc 8764101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 110
Target Start/End: Original strand, 16956483 - 16956563
Alignment:
30 tcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||| ||||||| ||||| |||||||||||||||||||| |||||| ||||||| |||||  |||||||||| |||||    
16956483 tcaggggtaacaacgtttgaccagtgcgcatgcctctacgcacgagccggattagtcactcacctttggtgggtcggaaac 16956563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 22 - 122
Target Start/End: Complemental strand, 50503460 - 50503360
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  ||||||||||||| |||||| |||||||||||||||||||| |||||| ||| ||||| |||   ||||||||| ||||| || |||||||    
50503460 ttcgattcccagggggaacaacacttgaccagtgcgcatgcctctacgcacgagccggatttgtcgcccaccaatggtgggtcggaaaccgatgcgaaag 50503361  T
122 c 122  Q
    |    
50503360 c 50503360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 12 - 87
Target Start/End: Original strand, 5504030 - 5504105
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||| || ||||||| ||||||  |||||||||||| |||||| ||||||||||||||||||||| ||||||||    
5504030 gaatatcaggttcgattctcagggaaaacaacgcttgattagtgcacatgcctctacgcatgagccggattagtcg 5504105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 22 - 69
Target Start/End: Complemental strand, 18649451 - 18649404
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacg 69  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||    
18649451 ttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacg 18649404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 34 - 87
Target Start/End: Complemental strand, 9659266 - 9659213
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||    
9659266 ggggaacaacgtttgactagtgcgcatgcctttacgcatgagccggattagtcg 9659213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 17642103 - 17642002
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  ||||||||||||| |||| | |||||||||||||||||||| |||||| ||||||||  |||  |||||||||| ||||| |  |||||||    
17642103 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaag 17642004  T
122 cc 123  Q
    ||    
17642003 cc 17642002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 103
Target Start/End: Original strand, 18915876 - 18915957
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggt 103  Q
    |||||||  ||||||||||||| |||| | |||| ||||||||||||||| |||||| |||||||||||||  |||||||||    
18915876 ttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgctcaccattggtgggt 18915957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 33498938 - 33498873
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||| ||||| ||| ||||||||| | ||||||||||||||||||||||||||| ||||||||    
33498938 ttcgattctcaggaggagcaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcg 33498873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 43959911 - 43959854
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||||||| | |||||||||||||||||||| |||||| |||||||||    
43959911 cagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgc 43959854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 49078123 - 49078224
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  |||||| |||||| |||| | ||||||||||||||||||||||||||| |||||||| ||||  ||||| |||| ||||| |  |||||||    
49078123 ttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtaggtcggaaaccggtgcgaaag 49078222  T
122 cc 123  Q
    ||    
49078223 cc 49078224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 35 - 123
Target Start/End: Original strand, 34719798 - 34719886
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||| |||||||||| |||||||||||||||||||| ||| |  |||||||||||||  |||||||||| ||||| |  |||||||||    
34719798 gggaataacgcttgaccagtgcgcatgcctctacgcacgagtcagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 34719886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 45361981 - 45361893
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||| ||||| ||||||||||||| | |||||||||||| |||||||| ||||| |||||||| ||||  || ||||||| |||||    
45361981 ttcgattctcaggaggaacaacgcttggccagtgcgcatgccactacgcataagccggattagtcgttcacctttagtgggtcggaaac 45361893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 32 - 87
Target Start/End: Complemental strand, 38791699 - 38791644
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||| ||||||| ||| | ||||||||||||||||||||||||||||||||||||    
38791699 aggggaaacaacgattggcaagtgcgcatgcctctacgcatgagccgaattagtcg 38791644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 92
Target Start/End: Complemental strand, 18708639 - 18708569
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    |||||||| |||||| | ||| ||||| ||||||||||||||||||| ||||||||  |||||||||||||    
18708639 ttcgatttccaggggaagcaatgcttggctagtgcgcatgcctctacacatgagccagattagtcgctcac 18708569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 33004116 - 33004050
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    |||||||||| |||||| ||||| ||||| | |||||||||||||||||||| |||||| |||||||    
33004116 gattcgatttccaggggaaacaatgcttggccagtgcgcatgcctctacgcacgagccggattagtc 33004050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 37 - 110
Target Start/End: Complemental strand, 10173055 - 10172982
Alignment:
37 gaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||| | ||||| ||||||||||||||||||||| |||| |||| |||  |||||||||| |||||    
10173055 gaacaacgcttggccagtgcccatgcctctacgcatgagccggattactcgcccacctttggtgggtcggaaac 10172982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 10422797 - 10422862
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||  ||| |||||||| |||| | ||||||||||||||||||||||||||| ||||||||    
10422797 ttcgatttctaggaggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcg 10422862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 16263554 - 16263619
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||| |||| ||||||||||||| | ||||||||||||||||||||| ||||| | ||||||    
16263554 ttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcataagccggaatagtcg 16263619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 26325821 - 26325922
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  ||| ||||||||| ||||   ||||||||||||||||||||||||||| ||||||||  |||  |||||||||| ||||| |  |||||||    
26325821 ttcgattcccagcgggaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 26325920  T
122 cc 123  Q
    ||    
26325921 cc 26325922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 41663955 - 41663854
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  ||||||||||||| ||||   ||||||||||||||||||||||||| | ||||||||  |||  |||||||||| ||||| |  |||||||    
41663955 ttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 41663856  T
122 cc 123  Q
    ||    
41663855 cc 41663854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 42710237 - 42710172
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||| |||||  |||| | ||||||||||||||||||||| | ||||||||||||    
42710237 ttcgattttcaggggaaacaatacttggccagtgcgcatgcctctacgcataaaccgaattagtcg 42710172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 32889 - 32945
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||| |||||||||||||   ||||| ||||||||||||||||||||||||||||||    
32889 caggaggaacaacgcttggtcagtgcacatgcctctacgcatgagccgaattagtcg 32945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 15465974 - 15466062
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||| ||||||||||||||||||   ||||| |||||||||||||| ||| |  ||| |||||||||  |||||||||| |||||    
15465974 ttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgagtctgattggtcgctcacctttggtgggtcggaaac 15466062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 17358570 - 17358482
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||| |||||| |||||||||||||| | ||||||||||| ||||||||||||  |||||| | |||   || |||||||||||||    
17358570 ttcgattctcagggagaacaacgcttgaccaatgcgcatgcctttacgcatgagcccgattagttgttcatctttagtgggtcagaaac 17358482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 26660147 - 26660234
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||| || ||||||||||  ||||  ||| ||||||||||||||||||||||| ||||||||| |||  |||||||||| |||||    
26660147 ttcgatttccacggggaacaacatttgatcagtacgcatgcctctacgcatgagccggattagtcgc-cacctttggtgggtcggaaac 26660234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 35908764 - 35908832
Alignment:
20 gattcgattttcagggggaacaacgcttgact-agtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||| |||||||||||| |||   | ||||||||||||||||||||||||||| ||||||||    
35908764 gattcgatttttagggggaacaacactttggtcagtgcgcatgcctctacgcatgagccggattagtcg 35908832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 40288576 - 40288488
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||| |||||||||||||| ||| | |||  |||||||||||| || |||||| ||||||||||||   |||||||||| |||||    
40288576 ttcgatttccagggggaacaacggttggccagtatgcatgcctctacacacgagccggattagtcgctcatccttggtgggtcggaaac 40288488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 17389779 - 17389845
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||||| |||||||||| | ||||| |||||||||||||| |||||||||| | ||||||||    
17389779 gattcgattttc-gggggaacaatgtttgaccagtgcgcatgcctccacgcatgagctggattagtcg 17389845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 33 - 103
Target Start/End: Original strand, 37339840 - 37339910
Alignment:
33 gggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggt 103  Q
    ||||| |||||||||| | |||||||||||||| ||||| |||||| ||||||||| |||  |||||||||    
37339840 ggggggacaacgcttggccagtgcgcatgcctcaacgcacgagccggattagtcgcccacctttggtgggt 37339910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 17092576 - 17092511
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||| ||||||| ||| | |||| | ||||||||||||| |||||| ||||||||    
17092576 ttcgattttcaggggaaacaacgattggccagtgtgtatgcctctacgcacgagccggattagtcg 17092511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 92
Target Start/End: Complemental strand, 28324649 - 28324609
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    ||||||||||||||||||||||||||| ||||||| |||||    
28324649 agtgcgcatgcctctacgcatgagccggattagtcactcac 28324609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 17350113 - 17350160
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
17350113 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 17350160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 32 - 87
Target Start/End: Complemental strand, 33418204 - 33418149
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||| |||||||||| | |||||||||||||||| ||| |||||| ||||||||    
33418204 aggggggacaacgcttggccagtgcgcatgcctctatgcacgagccggattagtcg 33418149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 39238768 - 39238815
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
39238768 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 39238815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 52833149 - 52833102
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| ||||||| ||||||||||||||||||| || ||||||||    
52833149 gttcgaaccccggacatcccatttattcactttaaaagtgaatttcta 52833102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 207 - 253
Target Start/End: Original strand, 7438673 - 7438719
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttct 253  Q
    ||||||||||||||||||||| |||||||  |||||||| |||||||    
7438673 gttcgaactccggacaccccacttattcatcttaaaggtgaatttct 7438719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 56 - 110
Target Start/End: Complemental strand, 35211237 - 35211183
Alignment:
56 cgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||||||||| ||||||||||  |||  |||||||||| |||||    
35211237 cgcatgcctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaac 35211183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 37 - 87
Target Start/End: Original strand, 44969688 - 44969738
Alignment:
37 gaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||||| | |||| ||||||| |||||||||||||| ||||||||    
44969688 gaacaacgcttggccagtgtgcatgcccctacgcatgagccggattagtcg 44969738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 50371933 - 50371867
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||  |||||||||||| | ||| ||||||| ||||||||  ||||| |||||||||    
50371933 ttcgattttcaggaagaacaacgcttggccagtacgcatgcttctacgcacaagccggattagtcgc 50371867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 77
Target Start/End: Complemental strand, 12036833 - 12036788
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagcc 77  Q
    ||||||||||| ||||| | |||||||||||||||||||| |||||    
12036833 agggggaacaatgcttggccagtgcgcatgcctctacgcacgagcc 12036788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 18808282 - 18808335
Alignment:
30 tcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaatta 83  Q
    |||| |||||||||||||||| ||||||||||||| || | |||||||| ||||    
18808282 tcagagggaacaacgcttgaccagtgcgcatgcctttatgtatgagccggatta 18808335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 38 - 79
Target Start/End: Original strand, 19195391 - 19195432
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccga 79  Q
    ||||||| ||| | ||||||||||||||||||||||||||||    
19195391 aacaacgtttggccagtgcgcatgcctctacgcatgagccga 19195432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 38021303 - 38021348
Alignment:
206 agttcgaactccggacaccccatttattcactttaaaggtaaattt 251  Q
    ||||||||| |||||||||||| |||||||||||||| || |||||    
38021303 agttcgaaccccggacaccccacttattcactttaaaagtgaattt 38021348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 87
Target Start/End: Complemental strand, 47312986 - 47312933
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||| ||| | |||||| |||||||||||||||||||  ||||||||    
47312986 ggggaacaacgtttggccagtgcgtatgcctctacgcatgagccagattagtcg 47312933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 87
Target Start/End: Original strand, 50094925 - 50094978
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||| ||||| ||| ||||||| |||||||||||| || ||||||||    
50094925 ggggaacaacgtttgaccagtacgcatgcttctacgcatgagtcggattagtcg 50094978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 10507716 - 10507772
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||| ||||||||| ||| | |||| |||| ||||||||||||||||| ||||||||    
10507716 caggaggaacaacgtttggccagtgtgcatacctctacgcatgagccggattagtcg 10507772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 23368775 - 23368731
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaattt 251  Q
    |||||||| |||||||||||| |||||||| |||||||| |||||    
23368775 gttcgaaccccggacaccccacttattcacattaaaggtgaattt 23368731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 207 - 243
Target Start/End: Original strand, 29491522 - 29491558
Alignment:
207 gttcgaactccggacaccccatttattcactttaaag 243  Q
    |||||||| |||||||||||| |||||||||||||||    
29491522 gttcgaaccccggacaccccacttattcactttaaag 29491558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 201 - 253
Target Start/End: Complemental strand, 29936730 - 29936678
Alignment:
201 gtcgaagttcgaactccggacaccccatttattcactttaaaggtaaatttct 253  Q
    |||| |||||||||||||||||||||| |||||||  ||||| || |||||||    
29936730 gtcggagttcgaactccggacaccccacttattcatcttaaaagtgaatttct 29936678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 57; Significance: 1e-23; HSPs: 44)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 22 - 122
Target Start/End: Original strand, 8141114 - 8141214
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||| |||||| ||||||||||| | ||||||||||||||||||||||||| ||||||||||  |||  |||||||||||||||| || |||||||    
8141114 ttcgatttccaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagctgaattagtcgtccacatttggtgggtcagaaaccgatgcgaaag 8141213  T
122 c 122  Q
    |    
8141214 c 8141214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 20 - 110
Target Start/End: Original strand, 43032911 - 43033001
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||  |||||||||||||||||| | ||||||||||||||||| || |||||| ||||||||| |||  ||||||||||||||||    
43032911 gattcgattcccagggggaacaacgcttggccagtgcgcatgcctctacacacgagccggattagtcgcccacctttggtgggtcagaaac 43033001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 18374022 - 18374087
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||    
18374022 ttcgattctcagggagaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcg 18374087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 36 - 123
Target Start/End: Original strand, 10927632 - 10927719
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||||||| | ||||||||||||||||||||||||||| |||||||| ||||  || ||||||| ||||| || |||||||||    
10927632 ggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccgatgcgaaagcc 10927719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 33401897 - 33401831
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||||||||||| |||||| |||| ||||||||||||||||||| || |||||||||    
33401897 ttcgattttcagggggaacaacacttgaccagtgtgcatgcctctacgcatgagtcggattagtcgc 33401831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 45521192 - 45521268
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||| |||||  ||||||||||||||||||||||||||| |||||||||||||  ||| |||||| |||||    
45521192 ggggaacaacacttgatcagtgcgcatgcctctacgcatgagccggattagtcgctcacctttgatgggtcggaaac 45521268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 22 - 104
Target Start/End: Complemental strand, 16291301 - 16291219
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    |||||||||||||||||||||| |||| | ||| | |||||||||| |||||||| | |||||||||||||  ||||||||||    
16291301 ttcgattttcagggggaacaacacttggccagtacacatgcctctatgcatgagctggattagtcgctcacctttggtgggtc 16291219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 35 - 88
Target Start/End: Original strand, 583837 - 583890
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||||| |||||||||||||||||||||||| || |||||||||    
583837 gggaacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgc 583890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 34 - 110
Target Start/End: Complemental strand, 4479382 - 4479306
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||| | ||||||||||||||||||||||||| | ||||||||  |||  |||||||||| |||||    
4479382 ggggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaac 4479306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 27 - 123
Target Start/End: Complemental strand, 11298360 - 11298264
Alignment:
27 ttttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||| ||||||||| |||  | |||||||||||||||| ||||||||| ||||| ||||||||  |||||||||| ||||| |  |||||||||    
11298360 ttttcagagggaacaacacttagccagtgcgcatgcctctatgcatgagccaaattaatcgctcacctttggtgggtcggaaaccggtgcgaaagcc 11298264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 34 - 110
Target Start/End: Complemental strand, 15884642 - 15884566
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||| |||| | |||||||||||||||||||| |||||| ||||||||| |||  |||||||||| |||||    
15884642 ggggaacaacacttggcaagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaac 15884566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 92
Target Start/End: Complemental strand, 1013075 - 1013005
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    |||||||  |||||||||||||||||| | ||| | |||||||||||||||||||||||||| ||| ||||    
1013075 ttcgattcccagggggaacaacgcttggccagtacacatgcctctacgcatgagccgaattaatcgttcac 1013005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 92
Target Start/End: Original strand, 6100484 - 6100554
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    |||||||  |||| ||||||||||||| | |||||||||||| |||||||||||||| |||||||| ||||    
6100484 ttcgattcccaggaggaacaacgcttggccagtgcgcatgccactacgcatgagccggattagtcgttcac 6100554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 34 - 92
Target Start/End: Complemental strand, 10535490 - 10535432
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    |||||||| |||||||| |||||||||| ||| ||||||||||||||||||||| ||||    
10535490 ggggaacaccgcttgaccagtgcgcatgtctccacgcatgagccgaattagtcgttcac 10535432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 2467216 - 2467151
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||| ||||||||||||| |||| | |||||||||| ||||| |||||||||| ||||||||    
2467216 ttcgatttccagggggaacaactcttggccagtgcgcatgtctctatgcatgagccggattagtcg 2467151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 34 - 106
Target Start/End: Original strand, 6042845 - 6042917
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcag 106  Q
    ||||||||||||||| | |||||||||||||  |||||||||||| ||||||||| |||   |||||||||||    
6042845 ggggaacaacgcttggccagtgcgcatgcctaaacgcatgagccggattagtcgcccaccactggtgggtcag 6042917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 35 - 91
Target Start/End: Original strand, 28333062 - 28333118
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctca 91  Q
    ||||| |||||||||| |||||||||| ||||||| |||||| ||||||||||||||    
28333062 gggaataacgcttgaccagtgcgcatgtctctacgtatgagctgaattagtcgctca 28333118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 123
Target Start/End: Original strand, 2964102 - 2964189
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||||||| | | || ||||||||||||||| || ||| ||||||||| |||  |||||||||||||||| |  |||||||||    
2964102 ggaacaacgcttggccaatgtgcatgcctctacgcacgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagcc 2964189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 31 - 78
Target Start/End: Complemental strand, 8587028 - 8586981
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccg 78  Q
    |||||||||||||||||| | ||||||||| |||||||||||||||||    
8587028 cagggggaacaacgcttggccagtgcgcatacctctacgcatgagccg 8586981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 22 - 85
Target Start/End: Original strand, 17981453 - 17981516
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagt 85  Q
    |||||||  ||||||||||||| |||||| |||| ||||||||||||||| ||| |||||||||    
17981453 ttcgattcccagggggaacaactcttgaccagtgtgcatgcctctacgcacgagtcgaattagt 17981516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 32 - 86
Target Start/End: Original strand, 3567926 - 3567980
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    |||||||||||| |||||| ||||| ||| |||||||||||||||| ||||||||    
3567926 agggggaacaacacttgaccagtgcacatacctctacgcatgagccaaattagtc 3567980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 104
Target Start/End: Complemental strand, 14666169 - 14666087
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    |||||||  |||||| |||||| |||| | ||||||||||||||||||||  ||||  ||||||||| ||| |||||||||||    
14666169 ttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcacaagccagattagtcgcccacagttggtgggtc 14666087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 88
Target Start/End: Original strand, 18091428 - 18091478
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||| ||||| |||||||||||||||||||| ||| ||||||||||||    
18091428 aacaacgtttgaccagtgcgcatgcctctacgcacgaggcgaattagtcgc 18091478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 32 - 110
Target Start/End: Complemental strand, 44893366 - 44893288
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||| ||||| | |||| ||||||||||||||| |||||| |||| ||||||||  ||| |||||| |||||    
44893366 agggggaacaatgcttggccagtgtgcatgcctctacgcacgagccggattaatcgctcacccttgatgggtcggaaac 44893288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 43027317 - 43027382
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  |||| ||||||||| ||| | | ||||||||||||||||||||||||| ||||||||    
43027317 ttcgattcccaggaggaacaacgattgtccaatgcgcatgcctctacgcatgagccggattagtcg 43027382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 3418611 - 3418523
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||| ||| |||||||| |||| | ||||||||||| |||||||||||| |  ||||||||  |||  || |||||||||||||    
3418611 ttcgatttttaggaggaacaacacttggccagtgcgcatgcgtctacgcatgagtcagattagtcgtccacctttagtgggtcagaaac 3418523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 32 - 92
Target Start/End: Complemental strand, 33935823 - 33935763
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    |||| ||||||| |||| | ||||||||||||| |||||||||| || |||||||||||||    
33935823 agggagaacaacacttggccagtgcgcatgcctatacgcatgagtcggattagtcgctcac 33935763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 258
Target Start/End: Original strand, 2696585 - 2696636
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttctaacca 258  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||| ||||    
2696585 gttcgaaccccggacaccccacttattcactttaaaagtgaatttctgacca 2696636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 2800071 - 2800118
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
2800071 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 2800118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 27 - 101
Target Start/End: Complemental strand, 22212609 - 22212534
Alignment:
27 ttttcagggggaacaacgctt-gactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgg 101  Q
    |||||||| |||||||||||| ||| ||| ||||||| |||||||| | |||| |||||||||||||  |||||||    
22212609 ttttcaggtggaacaacgctttgaccagtacgcatgcttctacgcacgggccggattagtcgctcacctttggtgg 22212534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 32 - 87
Target Start/End: Original strand, 26570946 - 26571001
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||||| | |||| | |||| ||||||||||||||| ||||||||    
26570946 agggggaacaacgcttggccagtgtgtatgcatctacgcatgagccggattagtcg 26571001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 123
Target Start/End: Original strand, 27975917 - 27976004
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    |||||||| |||||  |||| |||||||||||||| ||||||| |||| |||| |||  || ||||||||| ||| || |||||||||    
27975917 ggaacaacacttgatcagtgtgcatgcctctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagcc 27976004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 123
Target Start/End: Original strand, 28033186 - 28033273
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    |||||||| |||||  |||| |||||||||||||| ||||||| |||| |||| |||  || ||||||||| ||| || |||||||||    
28033186 ggaacaacacttgatcagtgtgcatgcctctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagcc 28033273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 35301206 - 35301159
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    ||||||||||||||||||| | |||||||||||||| || ||||||||    
35301206 gttcgaactccggacaccctacttattcactttaaaagtgaatttcta 35301159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 32 - 78
Target Start/End: Complemental strand, 7673745 - 7673699
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccg 78  Q
    ||||||||||||| ||| |||||| ||||||||||||||| ||||||    
7673745 agggggaacaacgtttggctagtgtgcatgcctctacgcacgagccg 7673699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 87
Target Start/End: Original strand, 22958781 - 22958847
Alignment:
21 attcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||| |||||||| |||||   |||| ||||| ||||| |||||||||| ||||||||    
22958781 attcgattttcagagggaacaatgcttggtcagtgtgcatgtctctatgcatgagccggattagtcg 22958847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 29933784 - 29933850
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||  ||||| ||||||| |||||| ||||  |||||||||||| |||||||| |||||||||    
29933784 ttcgattcccagggagaacaacacttgaccagtgtacatgcctctacgtatgagccggattagtcgc 29933850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 9860093 - 9860028
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  ||||||||||||| |||| | |||| |||||||||||| ||||||||  ||||||||    
9860093 ttcgattcccagggggaacaacacttggccagtgtgcatgcctctacacatgagccagattagtcg 9860028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 261
Target Start/End: Original strand, 10310343 - 10310388
Alignment:
216 ccggacaccccatttattcactttaaaggtaaatttctaaccatta 261  Q
    |||||||||||| |||||||||||||| || |||||||| ||||||    
10310343 ccggacaccccacttattcactttaaaagtgaatttctagccatta 10310388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 208 - 261
Target Start/End: Complemental strand, 36815505 - 36815453
Alignment:
208 ttcgaactccggacaccccatttattcactttaaaggtaaatttctaaccatta 261  Q
    ||||||||||||| |||||| |||||||||| ||| || |||||||||||||||    
36815505 ttcgaactccgga-accccacttattcacttcaaaagtgaatttctaaccatta 36815453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 52 - 92
Target Start/End: Original strand, 3692875 - 3692915
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    ||||||||| |||||||||||||||||||||| ||| ||||    
3692875 agtgcgcatacctctacgcatgagccgaattaatcgttcac 3692915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 22 - 86
Target Start/End: Original strand, 6940570 - 6940633
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    |||||||| |||| ||||||||||||| |||||||||||  || ||| |||||| ||||||||||    
6940570 ttcgatttccaggtggaacaacgcttggctagtgcgcat-actttacacatgagtcgaattagtc 6940633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 34 - 78
Target Start/End: Complemental strand, 28537477 - 28537433
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccg 78  Q
    ||||||||| ||||| ||||| |||||||||||||||| ||||||    
28537477 ggggaacaatgcttggctagttcgcatgcctctacgcacgagccg 28537433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 31129354 - 31129398
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaattt 251  Q
    |||||||| |||||||||||| |||||||||||||| || |||||    
31129354 gttcgaaccccggacaccccacttattcactttaaaagtgaattt 31129398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0170 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: scaffold0170
Description:

Target: scaffold0170; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 20 - 110
Target Start/End: Original strand, 9854 - 9944
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||| |||||||||||||||||| | |||||||||||||||||||| |||||| ||||||||  |||  ||||||||||||||||    
9854 gattcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcagaaac 9944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 54; Significance: 6e-22; HSPs: 61)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 9805013 - 9805114
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  |||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||  |||  |||||||||| |||||||  |||||||    
9805013 ttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaacaggtgcgaaag 9805112  T
122 cc 123  Q
    ||    
9805113 cc 9805114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 42086336 - 42086437
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||  |||  |||||||||| ||||| |  |||||||    
42086336 ttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaag 42086435  T
122 cc 123  Q
    ||    
42086436 cc 42086437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 14588715 - 14588650
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||| |||| |||||||||| ||||||||||||||||||||||||||| ||||||||    
14588715 ttcgattttcaggaggaataacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcg 14588650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 21 - 101
Target Start/End: Original strand, 40117423 - 40117503
Alignment:
21 attcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgg 101  Q
    ||||||||| |||||||||||||||||| | ||||||||||||||||||||||||||| |||| ||| ||||  |||||||    
40117423 attcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttggtgg 40117503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 24 - 111
Target Start/End: Original strand, 32874798 - 32874885
Alignment:
24 cgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaaca 111  Q
    ||||||||| ||||||||||||||||||||||||||| ||| |||||| ||||||||||| |||  |||  |||||||||| ||||||    
32874798 cgattttcaaggggaacaacgcttgactagtgcgcatacctttacgcacgagccgaattaatcgtccaccattggtgggtcggaaaca 32874885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 12081917 - 12081982
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||| ||||||||||||||||||| | ||||||||||| |||||||| |||||||||||||||    
12081917 ttcgattctcagggggaacaacgcttggccagtgcgcatgcatctacgcacgagccgaattagtcg 12081982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 4016353 - 4016265
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||| |||||||||||||| |||| | ||||||||||||||||| || |||||| |||||| ||||||  |||||||||| |||||    
4016353 ttcgattatcagggggaacaacacttggccagtgcgcatgcctctacacacgagccggattagttgctcaccattggtgggtcggaaac 4016265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 31 - 103
Target Start/End: Original strand, 19572742 - 19572814
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggt 103  Q
    ||||||||||||| |||| | ||||||||||||||||||||||||||| |||||||| ||||  |||||||||    
19572742 cagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtgggt 19572814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 36 - 123
Target Start/End: Original strand, 12705037 - 12705124
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||||||||| |||| |||||| ||||||||||| ||| ||||||||| |||  |||||||||||||||| |  |||||||||    
12705037 ggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagcc 12705124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 20 - 123
Target Start/End: Original strand, 13664267 - 13664370
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaa 119  Q
    ||||||||| |||||||||||||| |||| | ||||||||||||||||||||||||||  |||| ||| ||||  |||||| ||| ||||| |  |||||    
13664267 gattcgattatcagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattaatcgatcacctttggtgtgtcggaaaccggtgcgaa 13664366  T
120 agcc 123  Q
    ||||    
13664367 agcc 13664370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 20 - 110
Target Start/End: Original strand, 14728089 - 14728180
Alignment:
20 gattcgattttcaggggga-acaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||||||  ||||||||||   ||||||||||||||||||||||||||| |||||| ||||||  ||| |||||| |||||    
14728089 gattcgattttcagggggggacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagttgctcacctttgatgggtcggaaac 14728180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 31 - 110
Target Start/End: Complemental strand, 39099868 - 39099789
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||| |||| | ||||| ||||||||||||||||||||| ||||||||| |||  |||||||||| |||||    
39099868 cagggggaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 39099789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 22 - 92
Target Start/End: Complemental strand, 7308462 - 7308392
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    |||||||  ||||||||||||||||||   ||||| ||||||||||||||||||||| |||||||||||||    
7308462 ttcgattcccagggggaacaacgcttgggcagtgcacatgcctctacgcatgagccggattagtcgctcac 7308392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 26 - 88
Target Start/End: Complemental strand, 18262712 - 18262650
Alignment:
26 attttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||||||||||||||||||| ||||||||| ||||||| || |||||| |||||||||    
18262712 attttcagggggaacaacgcttgaccagtgcgcatacctctacacacgagccggattagtcgc 18262650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 1538440 - 1538541
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  ||||||||||||| |||| | ||||||||||||||||||||||||||| |||| |||  |||  |||||||||| ||||| |  |||||||    
1538440 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggaaaccggtgcgaaag 1538539  T
122 cc 123  Q
    ||    
1538540 cc 1538541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 23383666 - 23383754
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  |||||||||||||||||| | ||||||| ||||||||||||||||| | ||||||||  |||  |||||||||| |||||    
23383666 ttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaac 23383754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 25417281 - 25417193
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  |||||||||||||||||| | |||||||||||||||||| | |||||| |||||||  | ||  ||||||||||||||||    
25417281 ttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgaacgagccggattagtcatttaccattggtgggtcagaaac 25417193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 123
Target Start/End: Original strand, 9812895 - 9812982
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||||||| | |||| |||||| ||||||||||| ||| ||||||||| |||  |||||||||||||||| |  |||||||||    
9812895 ggaacaacgcttggccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagcc 9812982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 12 - 83
Target Start/End: Complemental strand, 20682725 - 20682654
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaatta 83  Q
    ||||||| | || ||||| |||||||||||||||||| | |||||||||||||||||||| |||||| ||||    
20682725 gaatattgggttagatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggatta 20682654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 101
Target Start/End: Original strand, 21149743 - 21149822
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgg 101  Q
    ||||||||||||||||||||||| ||||| |||||||||| ||||||||| |||  | ||||||||| |||  |||||||    
21149743 ttcgattttcagggggaacaacgtttgaccagtgcgcatgactctacgcacgagttggattagtcgcccaccattggtgg 21149822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 35561916 - 35561829
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaa 109  Q
    ||||| || ||| ||||||||| | |||| ||||||||||||||||| ||||||||  ||||||||||||| |||||| |||| ||||    
35561916 ttcgacttccagagggaacaacacctgaccagtgcgcatgcctctacacatgagccagattagtcgctcaccgttggtaggtcggaaa 35561829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 11845899 - 11845833
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||  ||||||||||||| ||| | |||||||||||||||||| ||||||||||||| ||||    
11845899 ttcgatttcgagggggaacaacgtttggccagtgcgcatgcctctacgtatgagccgaattaatcgc 11845833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 5732018 - 5731917
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  |||| ||||||||||||| | |||||||||||||||||| |||||||  |||||||| ||||  || ||||||| ||||| |  |||||||    
5732018 ttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgtatgagccagattagtcgttcacctttagtgggtcggaaaccggtgcgaaag 5731919  T
122 cc 123  Q
    ||    
5731918 cc 5731917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 12766140 - 12766241
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||| | ||| ||||||| ||||| | |||| |||||||||||||||||| ||  ||||||||| |||  |||||||||||||||| |  |||||||    
12766140 ttcgattctgaggaggaacaatgcttggccagtgtgcatgcctctacgcatgaaccagattagtcgcccacctttggtgggtcagaaaccggtgcgaaag 12766239  T
122 cc 123  Q
    ||    
12766240 cc 12766241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 91
Target Start/End: Original strand, 30995130 - 30995199
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctca 91  Q
    |||||||  ||||||||||||| |||| | || ||||||||||||||||| |||||| ||||||||||||    
30995130 ttcgattcccagggggaacaacacttggccagggcgcatgcctctacgcacgagccggattagtcgctca 30995199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 41800986 - 41801051
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||| ||| ||||||||||||||||| | |||||||| ||||||||| |||||| ||||||||    
41800986 ttcgattctcaaggggaacaacgcttgaccaatgcgcatgtctctacgcacgagccggattagtcg 41801051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 12 - 76
Target Start/End: Original strand, 25467409 - 25467473
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagc 76  Q
    ||||| ||||||||||||||||| ||||||||| ||| | ||| |||||||||||||||| ||||    
25467409 gaatactagattcgattttcaggaggaacaacgattggccagtacgcatgcctctacgcacgagc 25467473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 78
Target Start/End: Original strand, 28857137 - 28857193
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccg 78  Q
    |||||||  ||||||||||||| |||| | |||||||||||||||||||||||||||    
28857137 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccg 28857193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 34 - 110
Target Start/End: Complemental strand, 38897805 - 38897729
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||| | |||||||||||||||||||| |||||| |||||| || |||  ||||||| || |||||    
38897805 ggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagttgcccacctttggtggatcggaaac 38897729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 27 - 87
Target Start/End: Original strand, 43399142 - 43399202
Alignment:
27 ttttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||| |||||||| | |||||||||||||||||||| |||| | ||||||||    
43399142 ttttcagggggaataacgcttggccagtgcgcatgcctctacgcacgagcaggattagtcg 43399202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 207 - 258
Target Start/End: Complemental strand, 4674858 - 4674807
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttctaacca 258  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||||||    
4674858 gttcgaaccccggacaccccacttattcactttaaaagtgaatttctaacca 4674807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 9168337 - 9168286
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||| | ||||||||| ||||||||||||||||| ||||||||    
9168337 ggaacaacgcttggccagtgcgcatacctctacgcatgagccggattagtcg 9168286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 34 - 85
Target Start/End: Original strand, 20590020 - 20590071
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagt 85  Q
    ||||||||||||||| | |||||||||| |||||||||||||||| ||||||    
20590020 ggggaacaacgcttggccagtgcgcatgactctacgcatgagccgtattagt 20590071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 207 - 258
Target Start/End: Complemental strand, 36045177 - 36045126
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttctaacca 258  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||||||    
36045177 gttcgaaccccggacaccccacttattcactttaaaagtgaatttctaacca 36045126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 87
Target Start/End: Complemental strand, 3653997 - 3653947
Alignment:
37 gaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||||||| |||||||||||||||||||| ||| || ||||||||    
3653997 gaacaacgcttgaccagtgcgcatgcctctacgcacgaggcggattagtcg 3653947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 36 - 110
Target Start/End: Original strand, 7866604 - 7866678
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||| | |||| ||||||||||||||| || ||| ||||||||| |||  ||||||||| ||||||    
7866604 ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacctttggtgggttagaaac 7866678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 87
Target Start/End: Original strand, 20255393 - 20255443
Alignment:
37 gaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||| |||||| |||||||||||||||||||||||| || ||||||||    
20255393 gaacaacacttgaccagtgcgcatgcctctacgcatgagtcggattagtcg 20255443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 24463984 - 24463918
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||||| || |||||||| ||| | |||||||||||||||| ||| |||||| |||||||||    
24463984 ttcgattttcaaggcgaacaacgattggccagtgcgcatgcctctatgcacgagccggattagtcgc 24463918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 20525847 - 20525912
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  |||| |||||||| |||  | ||||||||||||||||||||||||||| ||||||||    
20525847 ttcgattcccaggtggaacaacacttcgccagtgcgcatgcctctacgcatgagccggattagtcg 20525912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 61 - 110
Target Start/End: Original strand, 28857194 - 28857243
Alignment:
61 gcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||||||||| |||||||||||||  |||||||||| |||||    
28857194 gcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaac 28857243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 34 - 87
Target Start/End: Original strand, 37263261 - 37263314
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||| | | |||||||||||||||||| |||||| ||||||||    
37263261 ggggaacaacgcttggccaatgcgcatgcctctacgcacgagccggattagtcg 37263314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 53 - 121
Target Start/End: Original strand, 2485236 - 2485304
Alignment:
53 gtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||||||||||||| ||||| || |||||||||||||  ||| |||||| ||||| || |||||||    
2485236 gtgcgcatgcctctacgtatgagtcggattagtcgctcacctttgatgggtcggaaaccgatgcgaaag 2485304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 68
Target Start/End: Original strand, 19839334 - 19839382
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctac 68  Q
    ||||| ||||||||| ||||||||||||||  |||||||||||||||||    
19839334 gattcaattttcaggaggaacaacgcttgatcagtgcgcatgcctctac 19839382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 66
Target Start/End: Original strand, 21487626 - 21487670
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctct 66  Q
    ||||||||||||| ||||||||| ||| |||||||||||||||||    
21487626 ttcgattttcaggaggaacaacgtttggctagtgcgcatgcctct 21487670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 92
Target Start/End: Original strand, 28862824 - 28862904
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    |||||| || ||||||| ||||| ||||||||||||| | | ||| |||||||||||||| || | |||||||| ||||||    
28862824 gaatatcaggttcgattctcaggcggaacaacgcttggccaatgcacatgcctctacgcacgacctgaattagttgctcac 28862904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 42291594 - 42291538
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||| |||||||||||| | ||||| |||||||||||||| |||||| ||||||||    
42291594 cagggtgaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcg 42291538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 1463923 - 1463970
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
1463923 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 1463970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 12 - 91
Target Start/End: Original strand, 26077140 - 26077219
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctca 91  Q
    ||||| ||| |||||||  ||| |||||||||||||| | ||||| |||||||||||||| |||||  |||| |||||||    
26077140 gaatactaggttcgattcccagagggaacaacgcttggccagtgcacatgcctctacgcacgagccagattaatcgctca 26077219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 32 - 87
Target Start/End: Original strand, 30349598 - 30349653
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||| | ||| | |||||||||||||||| |||||||| ||||||||||    
30349598 agggggaacaatgattggccagtgcgcatgcctctatgcatgagctgaattagtcg 30349653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 26 - 77
Target Start/End: Complemental strand, 35245100 - 35245049
Alignment:
26 attttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagcc 77  Q
    |||||||| |||||||||| ||||| |||| |||||| ||||||||||||||    
35245100 attttcagagggaacaacgtttgaccagtgtgcatgcttctacgcatgagcc 35245049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 50 - 88
Target Start/End: Complemental strand, 6764527 - 6764489
Alignment:
50 ctagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||||||||||| |||||| |||||||||    
6764527 ctagtgcgcatgcctctacgcacgagccggattagtcgc 6764489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 34 - 88
Target Start/End: Original strand, 25452946 - 25453000
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||| | ||||| |||| ||||||||||||||| |||||| |||||||||    
25452946 ggggaacaatgtttgaccagtgtgcatgcctctacgcacgagccggattagtcgc 25453000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 92
Target Start/End: Original strand, 39728396 - 39728466
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    ||||||| |||| || |||||| |||| | |||| ||||||||||||||  ||| ||||||||||||||||    
39728396 ttcgattatcagaggaaacaacacttggccagtgtgcatgcctctacgctcgagtcgaattagtcgctcac 39728466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 38 - 104
Target Start/End: Complemental strand, 42861300 - 42861234
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    |||||| |||| | ||||||||||||||||||||||||||| |||| |||  |||  ||||||||||    
42861300 aacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtc 42861234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 87
Target Start/End: Complemental strand, 14974410 - 14974357
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||  ||| | ||||| ||||||||||||||||||||| ||||||||    
14974410 ggggaacaacatttggccagtgcacatgcctctacgcatgagccggattagtcg 14974357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 25 - 101
Target Start/End: Original strand, 5079343 - 5079419
Alignment:
25 gattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgg 101  Q
    ||||| ||||||||||| ||||||   | ||||||||| |||||||| |||||| ||||||||| |||  |||||||    
5079343 gatttccagggggaacagcgcttggtcaatgcgcatgcttctacgcacgagccggattagtcgcccacctttggtgg 5079419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 20516508 - 20516460
Alignment:
13 aatattagattcgattttcagggggaacaacgcttgactagtgcgcatg 61  Q
    |||||| || |||||||| ||||||||||||||||| | ||||||||||    
20516508 aatattggaatcgatttttagggggaacaacgcttggccagtgcgcatg 20516460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 72
Target Start/End: Original strand, 20705570 - 20705622
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcat 72  Q
    ||||| |||||||||| |||||||| |||   |||||||||||||||||||||    
20705570 gattcaattttcagggagaacaacgtttggtcagtgcgcatgcctctacgcat 20705622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 35 - 87
Target Start/End: Original strand, 21375373 - 21375425
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||  ||||| ||||||||||| |||||||||||| || ||||||||    
21375373 gggaacaacatttgaccagtgcgcatgcttctacgcatgagtcggattagtcg 21375425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 22 - 122
Target Start/End: Complemental strand, 24653909 - 24653810
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||||||||| ||||||| ||||   ||||||||| ||||||||||| ||||| |||| |||  |||  ||||||||||  |||| || |||||||    
24653909 ttcgattttcagggagaacaacacttggtcagtgcgcatacctctacgcat-agccggattaatcgtccaccattggtgggtcgaaaaccgatgcgaaag 24653811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 66 - 110
Target Start/End: Original strand, 28857002 - 28857046
Alignment:
66 tacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||| |||||||||||||  |||||||||| |||||    
28857002 tacgcatgagccggattagtcgctcacctttggtgggtcggaaac 28857046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0291 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 6866 - 6954
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  ||||||||||||| |||| | ||||||||||||||||||||||||||| |||||||||||||  |||||||||| |||||    
6866 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaac 6954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 53; Significance: 3e-21; HSPs: 56)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 38578965 - 38578877
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  |||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||| |||  |||||||||| |||||    
38578965 ttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 38578877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 31 - 110
Target Start/End: Original strand, 13095878 - 13095957
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||| |||| | ||||||||||||||||||||||||||| |||||||||||||  |||||||||| |||||    
13095878 cagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaac 13095957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 27028290 - 27028378
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||| ||||||||||||| |||| | ||||||||||||||||| ||||||| | |||||||||||||  |||||||||| |||||    
27028290 ttcgatttccagggggaacaacacttggccagtgcgcatgcctctacacatgagctggattagtcgctcacctttggtgggtcggaaac 27028378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 34659237 - 34659303
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||| ||| ||||||||||||||||| |||||||||||||||||||| |||||| |||||||||    
34659237 ttcgattctcaaggggaacaacgcttgaccagtgcgcatgcctctacgcacgagccggattagtcgc 34659303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 5069913 - 5069812
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||| |||| ||||||||||||  |||||| |||||||||||||||  ||||| ||||||||| |||  |||||||||| ||||| || |||||||    
5069913 ttcgatttccaggaggaacaacgcttagctagtgtgcatgcctctacgcacaagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaag 5069814  T
122 cc 123  Q
    ||    
5069813 cc 5069812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 22973978 - 22974079
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||| ||||||||||||||||||| | |||| |||||| ||||||||||||||  ||||||||  |||  |||||||||||||||| |  |||||||    
22973978 ttcgattctcagggggaacaacgcttggccagtgtgcatgcgtctacgcatgagccagattagtcgtccacctttggtgggtcagaaaccggcgcgaaag 22974077  T
122 cc 123  Q
    ||    
22974078 cc 22974079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 36 - 123
Target Start/End: Complemental strand, 22993451 - 22993364
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||||||| | |||| ||||||||||||||| || ||| |||||||||||||  |||||||||||||||| |  |||||||||    
22993451 ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgctcacctttggtgggtcagaaaccggtgcgaaagcc 22993364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 1605952 - 1606053
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||| |||||||||||||||||| | ||||| |||||||||| || ||||||| ||||||||| |||  ||||||| || ||||| |  |||||||    
1605952 ttcgatttccagggggaacaacgcttggccagtgcacatgcctctaggcttgagccggattagtcgcccacctttggtggatcggaaaccggtgcgaaag 1606051  T
122 cc 123  Q
    ||    
1606052 cc 1606053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 10047974 - 10047873
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  ||||||||||||| |||| | |||||||| |||||||||||||||| ||||||||||  |||  |||||||||| ||||| |  |||||||    
10047974 ttcgattcccagggggaacaacacttggccagtgcgcaggcctctacgcatgagcagaattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 10047875  T
122 cc 123  Q
    ||    
10047874 cc 10047873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 103
Target Start/End: Original strand, 14650328 - 14650409
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggt 103  Q
    |||||||| |||| ||||||| ||||||| |||||  ||||||||||||||||||||  ||||||||||||  |||||||||    
14650328 ttcgatttccaggaggaacaatgcttgaccagtgcatatgcctctacgcatgagccgggttagtcgctcacctttggtgggt 14650409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 17748480 - 17748379
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  |||||||||||||||||| | |||||||||||||||||| | |||||| ||||||||  |||  ||| |||||| ||||| || |||||||    
17748480 ttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgtacgagccggattagtcgtccacctttgttgggtcggaaaccgatgcgaaag 17748381  T
122 cc 123  Q
    ||    
17748380 cc 17748379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 122
Target Start/End: Complemental strand, 4195300 - 4195200
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||| |||| ||||||||  ||| ||||||||||||||||||||||||||||| ||||| ||  |||  |||||||||  ||||| || |||||||    
4195300 ttcgatttccaggaggaacaacatttggctagtgcgcatgcctctacgcatgagccggattagccgtccaccattggtgggttggaaaccgatgcgaaag 4195201  T
122 c 122  Q
    |    
4195200 c 4195200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 16802132 - 16802216
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    ||||||||| | ||| ||||||||| ||| | |||||| ||||||||||||| |||||| |||||||||||||  ||||||||||    
16802132 gattcgattcttaggaggaacaacgattggccagtgcgtatgcctctacgcacgagccggattagtcgctcaccattggtgggtc 16802216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 23658190 - 23658278
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||| |||||||||||||||||| | |||| |||||||||||| || |||||| ||||||||  ||   ||||||||||||||||    
23658190 ttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacacacgagccggattagtcgtccatctttggtgggtcagaaac 23658278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 36619352 - 36619264
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  ||||||||||||| |||| | |||| |||||||||||||||||||||| ||||||||  |||  ||||||||||| ||||    
36619352 ttcgattcccagggggaacaacacttgtccagtgtgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcaaaaac 36619264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 86
Target Start/End: Complemental strand, 43862070 - 43862006
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    |||||||  |||||||||||||| ||| | ||||||||||||||||||||||||||| |||||||    
43862070 ttcgattcccagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtc 43862006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 48804706 - 48804782
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||| |||| | ||||||||||||||||||||||||||| ||||||||  |||  |||||||||| |||||    
48804706 ggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaac 48804782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 110
Target Start/End: Original strand, 21530768 - 21530847
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||| ||||   ||||| |||||||||||||| ||||||||||| ||||||||  |||||||||| |||||    
21530768 cagggggaacaacacttggtcagtgcacatgcctctacgcacgagccgaattaatcgctcacctttggtgggtcggaaac 21530847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 24304326 - 24304279
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||||||| ||||||||||||||||||||||| |||||||||||    
24304326 gttcgaactccgaacaccccatttattcactttaaaagtaaatttcta 24304279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 87
Target Start/End: Complemental strand, 28396250 - 28396193
Alignment:
30 tcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||||||  || |||||||||||| ||||||||||||| ||||||||    
28396250 tcagggggaacaacgcttagctggtgcgcatgcctttacgcatgagccggattagtcg 28396193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 30827303 - 30827368
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||||||| ||||||| |||| | ||| |||||||||||||||| |||||| ||||||||    
30827303 ttcgattttcagggagaacaacacttggccagtacgcatgcctctacgcacgagccggattagtcg 30827368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 38 - 123
Target Start/End: Complemental strand, 42210344 - 42210259
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||| ||| | |||||||||||||||||||| |||||| |||| || | ||| ||||||||||| ||||| || |||||||||    
42210344 aacaacgtttggccagtgcgcatgcctctacgcacgagccggattaatcacccaccgttggtgggtcggaaaccgatgcgaaagcc 42210259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 110
Target Start/End: Original strand, 14535306 - 14535390
Alignment:
26 attttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||| ||||||| |||| | |||| ||||||||||||||| |||| | ||||||||| |||  ||| ||||||||||||    
14535306 attttcagggagaacaacacttggccagtgtgcatgcctctacgcacgagctggattagtcgcccaccattgatgggtcagaaac 14535390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 35 - 87
Target Start/End: Original strand, 39420861 - 39420913
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||||||| | ||||||| ||||||||||||||||||| ||||||||    
39420861 gggaacaacgcttggccagtgcgcgtgcctctacgcatgagccggattagtcg 39420913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 12 - 75
Target Start/End: Complemental strand, 45697297 - 45697235
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgag 75  Q
    |||||| |||||||||| ||||||| |||||| |||||  ||||||||||||||||||||||||    
45697297 gaatatcagattcgattctcagggg-aacaacacttgatcagtgcgcatgcctctacgcatgag 45697235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 47341887 - 47341974
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaa 109  Q
    |||||||  ||||||||||||| |||| | |||||||||||||||||||| |||| | ||| |||| ||||  |||||||||| ||||    
47341887 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagcaggattggtcgttcaccattggtgggtcggaaa 47341974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 34 - 101
Target Start/End: Complemental strand, 48244442 - 48244375
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgg 101  Q
    ||||||||| ||||||  ||||||  ||||||||||||||||||| |||||||||||||  |||||||    
48244442 ggggaacaatgcttgatcagtgcgtttgcctctacgcatgagccggattagtcgctcacctttggtgg 48244375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 32 - 110
Target Start/End: Original strand, 18785690 - 18785768
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||| |||| | ||||||||||||||||||||||| | | |||||||| ||||   ||||||||| |||||    
18785690 agggggaacaacacttggccagtgcgcatgcctctacgcatgaactggattagtcgttcacctctggtgggtcggaaac 18785768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 207 - 253
Target Start/End: Complemental strand, 28914920 - 28914874
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttct 253  Q
    |||||||| |||||||||||| ||||||||||||||||| |||||||    
28914920 gttcgaaccccggacaccccacttattcactttaaaggtgaatttct 28914874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 52 - 109
Target Start/End: Original strand, 3603398 - 3603455
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaa 109  Q
    |||||||||||||||||||| |||||| |||| ||| ||||| |||||||||| ||||    
3603398 agtgcgcatgcctctacgcacgagccggattaatcgttcacttttggtgggtcggaaa 3603455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 207 - 256
Target Start/End: Original strand, 19126789 - 19126838
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttctaac 256  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||||    
19126789 gttcgaaccccggacaccccacttattcactttaaaagtgaatttctaac 19126838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 83
Target Start/End: Original strand, 22573824 - 22573884
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaatta 83  Q
    ||||||||||||||| ||||||  ||||| ||||||||||||| ||||||||||||| ||||    
22573824 ttcgattttcagggg-aacaacatttgaccagtgcgcatgcctttacgcatgagccggatta 22573884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 34 - 87
Target Start/End: Original strand, 39474963 - 39475016
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||||||||   ||||||||| ||||||||||||||||| ||||||||    
39474963 ggggaacaacgcttggtcagtgcgcatacctctacgcatgagccggattagtcg 39475016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 104
Target Start/End: Complemental strand, 24983487 - 24983435
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    ||||||||||||||||||||||||||| ||||||||  |||  ||||||||||    
24983487 agtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtc 24983435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 37514932 - 37515020
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||| |||||||||| |||   |||||||||| ||||||||| |||||| |||| ||| ||||  || ||||||| |||||    
37514932 ttcgattttcagtgggaacaacgtttggtcagtgcgcatgtctctacgcacgagccggattaatcgttcaccattagtgggtcggaaac 37515020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 87
Target Start/End: Original strand, 41945497 - 41945549
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||| |||||||| | |||||||||||||||||||| |||||| ||||||||    
41945497 gggaataacgcttggccagtgcgcatgcctctacgcacgagccggattagtcg 41945549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 110
Target Start/End: Complemental strand, 43346865 - 43346789
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||| |||| |  ||||||||||||||||| | |||||| ||||||||||||   |||||||||| |||||    
43346865 ggggaacaacacttggccggtgcgcatgcctctacgtacgagccggattagtcgctcatctttggtgggtcggaaac 43346789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 92
Target Start/End: Complemental strand, 45960071 - 45960031
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    ||||||||||||||||||||| ||||| |||||||||||||    
45960071 agtgcgcatgcctctacgcataagccggattagtcgctcac 45960031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 365151 - 365206
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagcc 77  Q
    |||||||  |||| |||||||||||| |  ||||||||||||||||||||||||||    
365151 ttcgattcacaggaggaacaacgcttaatcagtgcgcatgcctctacgcatgagcc 365206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 27875188 - 27875121
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||  ||||||||| ||| |||| | ||||| |||||||||||||||||| || ||||||||    
27875188 gattcgattcccagggggaataacacttggccagtgcacatgcctctacgcatgagtcgcattagtcg 27875121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 22 - 85
Target Start/End: Original strand, 43925523 - 43925586
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagt 85  Q
    |||||||  ||||||||||||| ||||   ||||||||||||||||||||||||| | ||||||    
43925523 ttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagt 43925586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 12 - 110
Target Start/End: Complemental strand, 8734794 - 8734696
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||| || ||||||||   |||||||||| |||||   |||||||||||||| ||||| |||||  ||||||||| |||  |||||||||| |||||    
8734794 gaatatcaggttcgatttcttgggggaacaatgcttgggcagtgcgcatgcctcaacgcacgagccagattagtcgcccacctttggtgggtcggaaac 8734696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 207 - 277
Target Start/End: Complemental strand, 31475883 - 31475813
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttctaaccattatattacttaacaaaaa 277  Q
    |||||||| || ||||||||| |||||||||||||| || |||||||| ||| || | ||| |||||||||    
31475883 gttcgaacccctgacaccccacttattcactttaaaagtgaatttctagccactagactacctaacaaaaa 31475813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 75
Target Start/End: Complemental strand, 41268023 - 41267969
Alignment:
22 ttcgattttcagggg-gaacaacgcttgactagtgcgcatgcctctacgcatgag 75  Q
    ||||||||| ||||| ||| ||||||||| ||||| |||||||||||||||||||    
41268023 ttcgatttttaggggagaataacgcttgattagtgtgcatgcctctacgcatgag 41267969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 45447981 - 45448027
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctac 68  Q
    |||||||| ||||| |||||||||||| ||||||||||| |||||||    
45447981 ttcgatttccagggagaacaacgcttggctagtgcgcatccctctac 45448027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 1797471 - 1797536
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  |||||| ||||||||||| | |||||||||| ||||||||| |||||| | ||||||    
1797471 ttcgattcccaggggaaacaacgcttggccagtgcgcatgtctctacgcacgagccggactagtcg 1797536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 101
Target Start/End: Complemental strand, 5039486 - 5039437
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgg 101  Q
    ||||| ||| ||||||||||||||||| |||||||||||||  |||||||    
5039486 agtgcacatacctctacgcatgagccggattagtcgctcacctttggtgg 5039437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 77
Target Start/End: Complemental strand, 19914787 - 19914746
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagcc 77  Q
    ||||||||||||| | | ||||||||||||||||||||||||    
19914787 ggaacaacgcttggccaatgcgcatgcctctacgcatgagcc 19914746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 207 - 236
Target Start/End: Original strand, 35368448 - 35368477
Alignment:
207 gttcgaactccggacaccccatttattcac 236  Q
    ||||||||||||||||||||||||||||||    
35368448 gttcgaactccggacaccccatttattcac 35368477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 85
Target Start/End: Original strand, 39230524 - 39230573
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagt 85  Q
    |||||||| |||||||| || ||||||||||| |||||||||| ||||||    
39230524 ggaacaacacttgactaatgtgcatgcctctatgcatgagccggattagt 39230573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 199 - 236
Target Start/End: Complemental strand, 48258235 - 48258198
Alignment:
199 gagtcgaagttcgaactccggacaccccatttattcac 236  Q
    |||||| ||||||||| |||||||||||||||||||||    
48258235 gagtcggagttcgaaccccggacaccccatttattcac 48258198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 49142757 - 49142704
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagt 85  Q
    ||||||||||||||||  | ||||| |||||||||||||| |||||| ||||||    
49142757 agggggaacaacgcttagccagtgcacatgcctctacgcacgagccggattagt 49142704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 88
Target Start/End: Complemental strand, 4228838 - 4228786
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||| ||| | ||||| |||||| |||||||||||||| |||||||||    
4228838 ggaacaacgtttggccagtgcacatgcccctacgcatgagccggattagtcgc 4228786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 40 - 88
Target Start/End: Complemental strand, 21190860 - 21190812
Alignment:
40 caacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||| |||||||||||||||||||||| ||| |  |||||||||    
21190860 caacgcttggctagtgcgcatgcctctacgcacgagtcagattagtcgc 21190812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 201 - 233
Target Start/End: Complemental strand, 38854057 - 38854025
Alignment:
201 gtcgaagttcgaactccggacaccccatttatt 233  Q
    ||||||||||||||||| |||||||||||||||    
38854057 gtcgaagttcgaactccagacaccccatttatt 38854025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 52 - 104
Target Start/End: Original strand, 38988941 - 38988993
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    ||||| ||||||||||||||||| ||| ||||||||||||   ||||||||||    
38988941 agtgcacatgcctctacgcatgaaccggattagtcgctcatctttggtgggtc 38988993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 53; Significance: 3e-21; HSPs: 42)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 13036102 - 13036014
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||||||||||||| |||| | ||||||||||||||||||||||||||  ||||||||  |||| |||||||||| |||||    
13036102 ttcgattttcagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattagtcgtccactattggtgggtcggaaac 13036014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 31 - 123
Target Start/End: Original strand, 12635835 - 12635927
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    |||||| ||||||||||| ||||||||||||||||||||||  ||||| ||||||||| |||| |||||||||| ||||| |  |||||||||    
12635835 caggggaaacaacgcttggctagtgcgcatgcctctacgcacaagccggattagtcgcccactattggtgggtcggaaaccggtgcgaaagcc 12635927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 12606439 - 12606508
Alignment:
19 agattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||||| |||||||||||||| ||| | |||||||||||||||||||| |||||| |||||||||    
12606439 agattcgatttccagggggaacaacgtttggccagtgcgcatgcctctacgcacgagccggattagtcgc 12606508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 14107456 - 14107355
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  |||| ||||||||||||||| ||||| ||||||||||||||||||||| ||||||||| || | || ||||||| ||||| |  |||||||    
14107456 ttcgattcccaggaggaacaacgcttgaccagtgcacatgcctctacgcatgagccggattagtcgcccattattagtgggtcggaaaccggtgcgaaag 14107357  T
122 cc 123  Q
    ||    
14107356 cc 14107355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 21898660 - 21898761
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  |||| ||||||||||||| | ||||||||||||||||||||||||||| |||||||| ||||  || ||||||| ||||| |  |||||||    
21898660 ttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaag 21898759  T
122 cc 123  Q
    ||    
21898760 cc 21898761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 5253321 - 5253233
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  ||||||||||||| |||| | ||||||||||||||||||||||||||| |||| |||| |||  |||||||||| |||||    
5253321 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgcccacctttggtgggtcggaaac 5253233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 22 - 122
Target Start/End: Original strand, 30410457 - 30410557
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||| ||||| |||||||| ||| || ||||||||||||||||||||||||| | |||| |||||||   |||||||||| ||||| || |||||||    
30410457 ttcgattctcaggaggaacaacacttaaccagtgcgcatgcctctacgcatgagctggattaatcgctcatctttggtgggtcggaaaccgatgcgaaag 30410556  T
122 c 122  Q
    |    
30410557 c 30410557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 36 - 123
Target Start/End: Complemental strand, 8612058 - 8611971
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||||||||| |||| |||||| ||||||||||| ||| ||||||||| |||  |||||||||||||||| |  |||||||||    
8612058 ggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagcc 8611971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 22 - 85
Target Start/End: Complemental strand, 29444863 - 29444800
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagt 85  Q
    ||||||||  ||||||||||||||||| | ||||||||||||||||||||||||||| ||||||    
29444863 ttcgatttctagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagt 29444800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 37 - 123
Target Start/End: Complemental strand, 9633708 - 9633622
Alignment:
37 gaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    |||||||||||| | |||||||||||||||||||| |||||| ||||||||| |||  |||||||||| ||||| |  |||||||||    
9633708 gaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 9633622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 6606195 - 6606094
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||| |||||||||||||| |||| | ||||  ||||||||||||||||||||| ||||||||  |||  |||||||||| ||||| |  |||||||    
6606195 ttcgattctcagggggaacaacacttggccagtgtacatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 6606096  T
122 cc 123  Q
    ||    
6606095 cc 6606094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 83
Target Start/End: Original strand, 8932673 - 8932734
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaatta 83  Q
    |||||||  ||||||||||||| |||| ||||||||||||||||||||||||||||| ||||    
8932673 ttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggatta 8932734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 83
Target Start/End: Original strand, 8944139 - 8944200
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaatta 83  Q
    |||||||  ||||||||||||| |||| ||||||||||||||||||||||||||||| ||||    
8944139 ttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggatta 8944200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 3601096 - 3601184
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||| ||||||||||||||||||| | ||||||||||||| ||| || |||||| ||||||||  |||  |||||||||| |||||    
3601096 ttcgattctcagggggaacaacgcttggccagtgcgcatgcctatacacacgagccggattagtcgtccacctttggtgggtcggaaac 3601184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 12 - 84
Target Start/End: Complemental strand, 9366531 - 9366459
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattag 84  Q
    |||||| || ||||||||| |||||||| |||||||| | |||||||||||||||||||| |||||| |||||    
9366531 gaatatcaggttcgatttttagggggaataacgcttggccagtgcgcatgcctctacgcacgagccggattag 9366459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 31 - 77
Target Start/End: Original strand, 31129198 - 31129244
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagcc 77  Q
    |||||||| ||||||||| ||||||||||||||||||||||||||||    
31129198 cagggggagcaacgcttggctagtgcgcatgcctctacgcatgagcc 31129244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 8938723 - 8938788
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  |||| |||||||| |||||| |||||||| || ||||||||||||||||||||||||    
8938723 ttcgattcccaggaggaacaacacttgaccagtgcgcaagcatctacgcatgagccgaattagtcg 8938788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 34 - 87
Target Start/End: Complemental strand, 29333225 - 29333172
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||| ||| | |||||||||||||||||||||||||||||| |||||    
29333225 ggggaacaacgtttggccagtgcgcatgcctctacgcatgagccgaatcagtcg 29333172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 13391297 - 13391364
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||||||||||| ||||| | ||| | |||||||||||||||||||| |||||| |||||||||    
13391297 gattcgattttcagggg-aacaatgtttggccagtgcgcatgcctctacgcacgagccggattagtcgc 13391364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 123
Target Start/End: Complemental strand, 30788937 - 30788850
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||| ||| | |||||||||||||||| ||| |||||| ||||||||| |||  |||||||||| ||||| |  |||||||||    
30788937 ggaacaacgtttggccagtgcgcatgcctctaggcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 30788850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 72
Target Start/End: Complemental strand, 33859417 - 33859367
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcat 72  Q
    ||||||||| ||||||||||||| ||| | |||||||||||||||||||||    
33859417 ttcgatttttagggggaacaacgtttgcccagtgcgcatgcctctacgcat 33859367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 9147313 - 9147378
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  |||||||||| || |||||| ||||| ||||||||||||||| ||||| ||||||||    
9147313 ttcgattcccagggggaacgacacttgaccagtgcacatgcctctacgcataagccggattagtcg 9147378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 50 - 123
Target Start/End: Complemental strand, 14783490 - 14783417
Alignment:
50 ctagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    |||||| |||||||||||||||||||||| ||||||||  |||  |||||||||| ||||| |  |||||||||    
14783490 ctagtgtgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagcc 14783417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 34954717 - 34954652
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||| ||||||||||||||| ||| | ||||| ||| ||||||||||||||||  ||||||||    
34954717 ttcgattctcagggggaacaacgtttggccagtgcacatacctctacgcatgagccagattagtcg 34954652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 19089519 - 19089575
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||| |||| | |||| ||||||||||||||| |||||| ||||||||    
19089519 cagggggaacaacacttggccagtgagcatgcctctacgcacgagccggattagtcg 19089575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 86
Target Start/End: Complemental strand, 32157261 - 32157201
Alignment:
26 attttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    ||||| || ||||||||| |||||| ||||||||| ||||||||||||||||  |||||||    
32157261 atttttagagggaacaacacttgaccagtgcgcatacctctacgcatgagccagattagtc 32157201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 58 - 109
Target Start/End: Original strand, 14326045 - 14326096
Alignment:
58 catgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaa 109  Q
    ||||||||||||||||||||| ||||||||||||   |||||||||| ||||    
14326045 catgcctctacgcatgagccggattagtcgctcatctttggtgggtcggaaa 14326096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 58 - 109
Target Start/End: Original strand, 14419055 - 14419106
Alignment:
58 catgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaa 109  Q
    ||||||||||||||||||||| ||||||||||||   |||||||||| ||||    
14419055 catgcctctacgcatgagccggattagtcgctcatctttggtgggtcggaaa 14419106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 261
Target Start/End: Original strand, 15126294 - 15126348
Alignment:
207 gttcgaactccggacaccccatttattcacttta-aaggtaaatttctaaccatta 261  Q
    |||||||||||||||||||||||||||||| ||| ||||| || ||||||||||||    
15126294 gttcgaactccggacaccccatttattcaccttataaggtgaa-ttctaaccatta 15126348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 29284170 - 29284217
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
29284170 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 29284217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 33628984 - 33628937
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
33628984 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 33628937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 5029829 - 5029895
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||| |||||| |||||||| |||   ||||||||||||||||||||||||  | |||||||||    
5029829 ttcgattctcagggagaacaacgtttggtcagtgcgcatgcctctacgcatgagttggattagtcgc 5029895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 207 - 253
Target Start/End: Complemental strand, 5641733 - 5641687
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttct 253  Q
    ||||||||||||||||||||| |||||||| || ||||| |||||||    
5641733 gttcgaactccggacaccccacttattcacctttaaggtgaatttct 5641687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 87
Target Start/End: Original strand, 8888893 - 8888959
Alignment:
21 attcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||| | ||| ||||||| ||| | ||||||||| |||||||||||||| || ||||||||    
8888893 attcgatttttaagggaaacaacgtttggccagtgcgcatacctctacgcatgagtcggattagtcg 8888959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 10311555 - 10311485
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    ||||||||||||||| | |||||||||| ||||||||| |||    |||||||||||||  ||||||||||    
10311555 ggggaacaacgcttggccagtgcgcatgtctctacgcacgagttagattagtcgctcaccattggtgggtc 10311485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 207 - 237
Target Start/End: Original strand, 23771085 - 23771115
Alignment:
207 gttcgaactccggacaccccatttattcact 237  Q
    |||||||||||||||||||||||||||||||    
23771085 gttcgaactccggacaccccatttattcact 23771115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 37 - 110
Target Start/End: Complemental strand, 2271386 - 2271313
Alignment:
37 gaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||  | |||||||||| ||||||||| |||||| ||||||||  |||  ||| ||||||||||||    
2271386 gaacaacgcttagccagtgcgcatgtctctacgcacgagccggattagtcgtccacctttgatgggtcagaaac 2271313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 87
Target Start/End: Complemental strand, 3588031 - 3587978
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||| | ||||| ||| ||||||||||||| ||| ||||||||    
3588031 ggggaacaacgcttggccagtgcacatacctctacgcatgaaccggattagtcg 3587978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 9179834 - 9179769
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  ||||||||||||| |||||| |||  |||| ||||||||||||||| | ||||||||    
9179834 ttcgattcccagggggaacaacacttgaccagtatgcatacctctacgcatgagctggattagtcg 9179769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 38 - 75
Target Start/End: Original strand, 11142631 - 11142668
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgag 75  Q
    ||||||| ||||| ||||||||||||||||||||||||    
11142631 aacaacgtttgaccagtgcgcatgcctctacgcatgag 11142668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 88
Target Start/End: Complemental strand, 17114981 - 17114929
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||||||| | | ||  ||||||||||||||||||||| |||||||||    
17114981 ggaacaacgcttggccaatggacatgcctctacgcatgagccggattagtcgc 17114929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 201 - 253
Target Start/End: Original strand, 17217004 - 17217056
Alignment:
201 gtcgaagttcgaactccggacaccccatttattcactttaaaggtaaatttct 253  Q
    |||| |||||||||||||||||||||| |||||||  || ||||| |||||||    
17217004 gtcggagttcgaactccggacaccccacttattcatctttaaggtgaatttct 17217056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 53; Significance: 3e-21; HSPs: 70)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 38962771 - 38962859
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||| ||||||||||||| | ||||||||||||||||||||||| ||| ||||||||  |||  ||||||||||||||||    
38962771 ttcgattttcaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaaccggattagtcgtccacctttggtgggtcagaaac 38962859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 6358252 - 6358167
Alignment:
19 agattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    ||||||||||| ||||||||||||| |||| | ||||||||||||||||||||||||||| ||||||||  |||  ||||||||||    
6358252 agattcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtc 6358167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 12455318 - 12455419
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||| |||||| ||||||||||  | |||||||||||||||||||| |||||| |||||||||||||  |||||||||| ||||| |  |||||||    
12455318 ttcgatttccaggggaaacaacgcttagccagtgcgcatgcctctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccggtgcgaaag 12455417  T
122 cc 123  Q
    ||    
12455418 cc 12455419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 41220643 - 41220744
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  |||| ||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||  || ||||||| ||||| |  |||||||    
41220643 ttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattagtcgttcacctttagtgggtcggaaaccggtgcgaaag 41220742  T
122 cc 123  Q
    ||    
41220743 cc 41220744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 10026714 - 10026626
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||| ||||||||||||||| ||| | ||||||||||||||||||||||||||| ||||||||  |||  |||||||||| |||||    
10026714 ttcgattctcagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcgaccacctttggtgggtcggaaac 10026626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 8410139 - 8410240
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  ||||||||||||| |||| | |||||||||||||||||||| |||||| ||||||||| |||| |||| ||||| ||||| |  |||||||    
8410139 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacttttggggggtcggaaaccggtgcgaaag 8410238  T
122 cc 123  Q
    ||    
8410239 cc 8410240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 21 - 110
Target Start/End: Complemental strand, 39201607 - 39201518
Alignment:
21 attcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||| ||||||||||||| | ||| | |||| |||||||||||||||||||||| |||||||| ||||  |||||||||| |||||    
39201607 attcgattctcagggggaacaatgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttggtgggtcggaaac 39201518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 32 - 122
Target Start/End: Original strand, 11069896 - 11069986
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagc 122  Q
    ||||||||||||| ||| | ||||||||| |||||||||| |||| ||||||||||  ||| ||||||||||| ||||| || ||||||||    
11069896 agggggaacaacgtttggccagtgcgcatacctctacgcacgagctgaattagtcgtccaccgttggtgggtcggaaaccgatgcgaaagc 11069986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 15079491 - 15079557
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||| |||||||||||||||||||| |||| ||||| ||||||||| ||||| ||||||||||    
15079491 ttcgatttccagggggaacaacgcttgaccagtgtgcatgactctacgcacgagccaaattagtcgc 15079557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 22 - 92
Target Start/End: Original strand, 16034945 - 16035015
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    ||||||||||||| ||||||||||||||| |||| |||||||| |||| | |||||| |||||||||||||    
16034945 ttcgattttcaggcggaacaacgcttgaccagtgtgcatgcctatacgtacgagccggattagtcgctcac 16035015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 32 - 110
Target Start/End: Complemental strand, 25540492 - 25540414
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||||| | |||||||||||||||||||| |||||| ||||||||  |||  |||||||||| |||||    
25540492 agggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaac 25540414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 103
Target Start/End: Original strand, 331509 - 331590
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggt 103  Q
    |||||||  ||||||||||||| |||| | ||||||||||| ||||||||||||||| ||||||||| |||  |||||||||    
331509 ttcgattcccagggggaacaacacttggccagtgcgcatgcttctacgcatgagccggattagtcgcccacctttggtgggt 331590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 54 - 123
Target Start/End: Complemental strand, 3811757 - 3811688
Alignment:
54 tgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||||||||||||||||||| |||| |||| |||  |||||||||||||||| || |||||||||    
3811757 tgcgcatgcctctacgcatgagccggattactcgcccacctttggtgggtcagaaaccgatgcgaaagcc 3811688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 13026509 - 13026408
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||| ||||| ||||||| | ||| | ||||||||||||||||||||||||||| |||||||   |||| ||||| |||||||||| || || ||||    
13026509 ttcgattatcaggaggaacaatgattggccagtgcgcatgcctctacgcatgagccggattagtcagccacttttggtaggtcagaaaccgatgcaaaag 13026410  T
122 cc 123  Q
    ||    
13026409 cc 13026408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 14169707 - 14169642
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||| || ||||||||||| |||||| |||||||||| |||||||||||||||| ||||||||    
14169707 ttcgattctccgggggaacaacacttgaccagtgcgcatgtctctacgcatgagccggattagtcg 14169642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 34 - 123
Target Start/End: Original strand, 38005422 - 38005511
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||||||||| | ||||||||||||||||| ||||||||| ||||||||| |||  ||||||| || ||||| |  |||||||||    
38005422 ggggaacaacgcttggccagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtggatcggaaactggtgcgaaagcc 38005511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 38 - 91
Target Start/End: Original strand, 41187873 - 41187926
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctca 91  Q
    ||||||||||||| |||||||||||||||||||||||| || ||||||||||||    
41187873 aacaacgcttgaccagtgcgcatgcctctacgcatgagacggattagtcgctca 41187926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 10046574 - 10046487
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||| ||| ||| ||||||| ||||| ||||||||||||||||||||||||||| ||||||||  |||  |||||||||| |||||    
10046574 ttcgattctcaagggaaacaacgtttgac-agtgcgcatgcctctacgcatgagccggattagtcgaccacctttggtgggtcggaaac 10046487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 31 - 123
Target Start/End: Original strand, 10823077 - 10823169
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    |||| ||||||||||||| | |||||||||||||||||||| |||||| ||||||||| |||  || ||||||| ||||| |  |||||||||    
10823077 caggaggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccaccttttgtgggtcggaaaccggtgcgaaagcc 10823169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 29653633 - 29653701
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||| |||||  |||||||||||   |||||||||||||||||||| ||||||||||||||||    
29653633 gattcgatttccagggaaaacaacgcttgggcagtgcgcatgcctctacgcacgagccgaattagtcgc 29653701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 44139492 - 44139580
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  |||||||||||||||||| | ||||||| |||||||||||| |||||| ||||||||| |||   ||||||||| |||||    
44139492 ttcgattcccagggggaacaacgcttggccagtgcgcgtgcctctacgcacgagccggattagtcgcccaccaatggtgggtcggaaac 44139580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 15234169 - 15234110
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgca 71  Q
    ||||| ||| ||||||| |||||||||||||| |||||| ||||||||||||||||||||    
15234169 gaatactaggttcgattctcagggggaacaacacttgaccagtgcgcatgcctctacgca 15234110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 52 - 103
Target Start/End: Complemental strand, 18649094 - 18649043
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggt 103  Q
    |||||||||||||||||||||||| || |||||||||||||| |||||||||    
18649094 agtgcgcatgcctctacgcatgagtcggattagtcgctcacttttggtgggt 18649043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 20 - 110
Target Start/End: Original strand, 12864230 - 12864320
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||| ||||||||||||| ||||   ||||||||||||||| ||||||||||  ||||||||  |||  |||||||||| |||||    
12864230 gattcgatttccagggggaacaacacttggtcagtgcgcatgcctctgcgcatgagccagattagtcgtccaccattggtgggtcggaaac 12864320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 104
Target Start/End: Original strand, 22593143 - 22593224
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    |||||||  |||||||||||||| ||| | ||||||||||||||||||||||||||| ||||||||  |||  ||||||||||    
22593143 ttcgattcccagggggaacaacg-ttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtc 22593224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 25 - 123
Target Start/End: Complemental strand, 34346382 - 34346284
Alignment:
25 gattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    |||| |||||||||||||| |||| | |||| ||||||||||||||||||| |  |||| ||||||||  |||||||||| ||||| |  |||||||||    
34346382 gattatcagggggaacaacacttggccagtgtgcatgcctctacgcatgagtcagattaatcgctcacctttggtgggtcggaaaccggtgcgaaagcc 34346284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 104
Target Start/End: Complemental strand, 45263765 - 45263683
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    |||||||  ||| |||||||||||||| | |||||||||||||||||||| |||||| |||| |||||||   ||||||||||    
45263765 ttcgattcccagagggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgctcatctttggtgggtc 45263683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 103
Target Start/End: Original strand, 2550876 - 2550957
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggt 103  Q
    |||||||  |||| |||||||| |||  | |||||||||| |||||||||||||||| ||||||||| |||| |||||||||    
2550876 ttcgattcccaggaggaacaacacttagccagtgcgcatgtctctacgcatgagccggattagtcgcccacttttggtgggt 2550957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 16325603 - 16325691
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  ||||||||||||| |||| | |||| |||||||||||||||||||||  ||||||||  |||  |||||||||| |||||    
16325603 ttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcatgagccagattagtcgtccaccattggtgggtcggaaac 16325691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 34 - 110
Target Start/End: Complemental strand, 18902616 - 18902540
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||||| ||||||| || ||||||||| |||||  ||||||||| |||  |||||||||| |||||    
18902616 ggggaacaacgcttgaccagtgcgcgtgtctctacgcacgagccagattagtcgcccacctttggtgggtcggaaac 18902540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 28616477 - 28616389
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||||||||| ||| ||||   |||||||||||||||||||| |||||  ||||||||| ||   || |||||||||||||    
28616477 ttcgattttcagggggaataacacttgggcagtgcgcatgcctctacgcacgagccagattagtcgcccatctttagtgggtcagaaac 28616389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 41032004 - 41031916
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  ||||||||||||| |||| | |||| ||||||||||||||| |||||| ||||||| | |||  |||||||||| |||||    
41032004 ttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcacccacctttggtgggtcggaaac 41031916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 36 - 88
Target Start/End: Original strand, 44945615 - 44945667
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||  ||||||||||||||||||||| |||||| |||||||||    
44945615 ggaacaacgcttggatagtgcgcatgcctctacgcacgagccggattagtcgc 44945667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 3643971 - 3643920
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||| | ||||||||||||||||||||||||| | ||||||||    
3643971 ggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcg 3643920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 123
Target Start/End: Original strand, 7747296 - 7747383
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||| ||| | |||| |||||||||||||||||||||| |||||||| ||||  || ||||||| ||||| |  |||||||||    
7747296 ggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagcc 7747383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 34 - 121
Target Start/End: Original strand, 33005771 - 33005858
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||||| |||| | |||||||||||||||||||||||| |  |||| ||||||||  || ||||||| ||||| || |||||||    
33005771 ggggaacaacacttggccagtgcgcatgcctctacgcatgaggcagattaatcgctcacctttagtgggtcggaaaccgatgcgaaag 33005858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 20 - 75
Target Start/End: Complemental strand, 37804991 - 37804936
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgag 75  Q
    |||||||||  ||||||||| |||||||| |||||||||||||| |||||||||||    
37804991 gattcgattcacagggggaataacgcttggctagtgcgcatgccgctacgcatgag 37804936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 7787064 - 7787130
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||| ||||||||||||  |||| | ||| |||||||||||||||| |||||| |||||||||    
7787064 ttcgatttccagggggaacaatacttggccagtacgcatgcctctacgcacgagccggattagtcgc 7787130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 88
Target Start/End: Complemental strand, 9360830 - 9360780
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||| ||| | |||||||||||||||||||| ||||||||||||||||    
9360830 aacaacgtttggccagtgcgcatgcctctacgcacgagccgaattagtcgc 9360780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 87
Target Start/End: Complemental strand, 13104908 - 13104858
Alignment:
37 gaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||||| | |||||||||||||||||||||||||  |||||||||    
13104908 gaacaacgcttggccagtgcgcatgcctctacgcatgagctaaattagtcg 13104858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 19976905 - 19976839
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||||||| |||| |||   |||||||||| |||||||||| || ||||||||||||    
19976905 ttcgattttcagggggaataacgtttggtcagtgcgcatgtctctacgcataagtcgaattagtcgc 19976839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 104
Target Start/End: Complemental strand, 42770741 - 42770667
Alignment:
30 tcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    ||||||||||||||||||| | ||||||||||||||| |||| |||||| |||| |||  |||  ||||||||||    
42770741 tcagggggaacaacgcttggccagtgcgcatgcctcttcgcacgagccggattaatcgtccacctttggtgggtc 42770667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 76
Target Start/End: Complemental strand, 43303390 - 43303336
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagc 76  Q
    ||||||||||| ||||||||||||||||| ||| |||||||||||| ||| ||||    
43303390 ttcgattttcaaggggaacaacgcttgaccagtacgcatgcctctatgcacgagc 43303336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 91
Target Start/End: Complemental strand, 2528439 - 2528370
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctca 91  Q
    |||||||  ||||||||||||||||||   |||| |||||||||||| ||| ||||| ||||||||||||    
2528439 ttcgattcccagggggaacaacgcttggtcagtgtgcatgcctctacacataagccggattagtcgctca 2528370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 38 - 91
Target Start/End: Original strand, 21286468 - 21286521
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctca 91  Q
    ||||||||||||| |||||||||||||||||||| |||| | ||||||| ||||    
21286468 aacaacgcttgaccagtgcgcatgcctctacgcacgagctggattagtcactca 21286521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 34 - 87
Target Start/End: Original strand, 24179588 - 24179641
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||| ||| | ||||| ||||||||||||||||||||| ||||||||    
24179588 ggggaacaacgtttggccagtgcacatgcctctacgcatgagccggattagtcg 24179641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 25 - 110
Target Start/End: Original strand, 27725951 - 27726036
Alignment:
25 gattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||| ||||| ||||||| ||||| | ||||||||||||||||||||  ||||| ||||||||| |||   ||||||||| |||||    
27725951 gattctcaggaggaacaatgcttggccagtgcgcatgcctctacgcactagccggattagtcgcccaccaatggtgggtcggaaac 27726036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 86
Target Start/End: Complemental strand, 28525554 - 28525489
Alignment:
22 ttcgattttcagggggaa-caacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    |||||||| ||||||||| |||| |||| | |||||||||||||||||||| |||||| |||||||    
28525554 ttcgatttccagggggaaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtc 28525489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 83
Target Start/End: Original strand, 34356214 - 34356275
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaatta 83  Q
    |||||||| ||||||||||||| ||||   |||||||||||||||| |||||||||| ||||    
34356214 ttcgatttccagggggaacaacacttggtcagtgcgcatgcctctatgcatgagccggatta 34356275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 34722688 - 34722789
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||| |||||| ||||||||||||   ||||| |||| ||||||||| |||||| ||||||||| |||  ||| ||| |||||||| |  |||||||    
34722688 ttcgattctcagggagaacaacgcttggtcagtgcacatgtctctacgcacgagccggattagtcgcccacctttgatggatcagaaaccggtgcgaaag 34722787  T
122 cc 123  Q
    ||    
34722788 cc 34722789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 35946758 - 35946834
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||| | | || ||||||||||||||| |||||| ||||||||  |||  |||||||||| |||||    
35946758 ggggaacaacgcttggccattgtgcatgcctctacgcacgagccggattagtcgtccaccattggtgggtcggaaac 35946834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 258
Target Start/End: Original strand, 2304342 - 2304393
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttctaacca 258  Q
    |||||||| |||||||||||| ||||| |||||||| || ||||||||||||    
2304342 gttcgaaccccggacaccccacttatttactttaaaagtgaatttctaacca 2304393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 31 - 110
Target Start/End: Original strand, 10669609 - 10669688
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||| |||||||||||| | |||||||||| ||||||||| ||| || |||| ||| ||||  |||||||||| |||||    
10669609 cagggagaacaacgcttggccagtgcgcatgtctctacgcacgagtcggattaatcgttcacctttggtgggtcggaaac 10669688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 29035028 - 29035075
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
29035028 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 29035075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 35 - 74
Target Start/End: Original strand, 30929370 - 30929409
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatga 74  Q
    ||||||||||||||||||||||||||| ||||| ||||||    
30929370 gggaacaacgcttgactagtgcgcatgtctctaagcatga 30929409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 34034402 - 34034449
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
34034402 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 34034449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 20612634 - 20612544
Alignment:
22 ttcgattttcagg-gggaacaacgcttgactagtgcgcatgcctctacgcatgagcc-gaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||| ||||| ||||||||| |||| | |||||||||||||||| ||||||||| | ||||||||  |||  |||||||||| |||||    
20612634 ttcgattctcaggagggaacaacacttggccagtgcgcatgcctctatgcatgagccgggattagtcgtccaccattggtgggtcggaaac 20612544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 90
Target Start/End: Complemental strand, 21180414 - 21180344
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctc 90  Q
    |||||||||  || || ||||||| |||| | ||||| |||||||||||||| |||||| |||||||||||    
21180414 gattcgattcccatggagaacaacacttggccagtgcacatgcctctacgcacgagccggattagtcgctc 21180344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 54 - 88
Target Start/End: Original strand, 21641990 - 21642024
Alignment:
54 tgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||||||||||||||||||| ||||    
21641990 tgcgcatgcctctacgcatgagccgaattaatcgc 21642024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 41187717 - 41187783
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||| | |||||||||||| |||||| ||||  |||||||||||||||||| |  |||||||||    
41187717 ttcgattatgagggggaacaacacttgaccagtgtccatgcctctacgcatgagacatattagtcgc 41187783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 87
Target Start/End: Complemental strand, 16813251 - 16813198
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||| ||||| ||| |||||||||||| ||| |||||| ||||||||    
16813251 ggggaacaacgtttgaccagtacgcatgcctctatgcacgagccggattagtcg 16813198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 87
Target Start/End: Complemental strand, 16852530 - 16852477
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||| ||||| ||| |||||||||||| ||| |||||| ||||||||    
16852530 ggggaacaacgtttgaccagtacgcatgcctctatgcacgagccggattagtcg 16852477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 24 - 101
Target Start/End: Original strand, 26805306 - 26805383
Alignment:
24 cgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgg 101  Q
    ||||||||||| | ||| ||| ||| | ||||| |||||||||||||||||| || ||||||||| |||  |||||||    
26805306 cgattttcaggagaaacgacgtttggccagtgcacatgcctctacgcatgagtcggattagtcgcccacctttggtgg 26805383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 87
Target Start/End: Original strand, 29421302 - 29421355
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||||||||   |||| ||||||||||||||||||| |||| ||||||    
29421302 ggggaacaacgcttgggcagtgagcatgcctctacgcatgagtcgaagtagtcg 29421355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 83
Target Start/End: Original strand, 37560181 - 37560242
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaatta 83  Q
    ||||||| ||| ||||||||||| |||   |||||||||||||||||||| |||||| ||||    
37560181 ttcgattctcaaggggaacaacgtttggtcagtgcgcatgcctctacgcacgagccggatta 37560242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 44422158 - 44422203
Alignment:
206 agttcgaactccggacaccccatttattcacttta-aaggtaaatt 250  Q
    ||||||||| |||||||||||| |||||||||||| ||||||||||    
44422158 agttcgaaccccggacaccccacttattcactttataaggtaaatt 44422203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 84
Target Start/End: Complemental strand, 20116696 - 20116648
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattag 84  Q
    |||||||||| || | | ||||||||||||||||||||||||| |||||    
20116696 ggaacaacgcatggccaatgcgcatgcctctacgcatgagccggattag 20116648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 190 - 242
Target Start/End: Original strand, 23903007 - 23903058
Alignment:
190 atatatagagagtcgaagttcgaactccggacaccccatttattcactttaaa 242  Q
    ||||||||| ||||| |||| |||||||||||||||||  |||||||||||||    
23903007 atatataga-agtcggagtttgaactccggacaccccacctattcactttaaa 23903058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 11 - 83
Target Start/End: Complemental strand, 31596541 - 31596469
Alignment:
11 agaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaatta 83  Q
    ||||||| || ||| ||||||||||||||||| | ||| | ||||| ||| | ||||||||||||| ||||||    
31596541 agaatatcaggttctattttcagggggaacaatgtttggccagtgcacatacttctacgcatgagctgaatta 31596469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 207 - 278
Target Start/End: Complemental strand, 31658017 - 31657946
Alignment:
207 gttcgaactccggacaccccatttattcacttt-aaaggtaaatttctaaccattatattacttaacaaaaag 278  Q
    ||||||||||| |||||| || ||||||||||| ||| ||||| ||||||||| || ||||||||| ||||||    
31658017 gttcgaactccagacacctcagttattcactttaaaaagtaaa-ttctaaccactagattacttaaaaaaaag 31657946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 52; Significance: 1e-20; HSPs: 72)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 22 - 121
Target Start/End: Original strand, 35315964 - 35316063
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  ||||||||||||| |||| | ||||||||||||||||||||||||| | ||||||||| |||| |||||||||| ||||| || |||||||    
35315964 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagctggattagtcgcccacttttggtgggtcggaaaccgatgcgaaag 35316063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 26043820 - 26043921
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  ||||| ||||||| |||| | ||||||||||||||||||||||||||| |||||||||||||  |||||| ||||||||| |  |||||||    
26043820 ttcgattcccagggagaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgagtcagaaaccggggcgaaag 26043919  T
122 cc 123  Q
    ||    
26043920 cc 26043921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 29127927 - 29128028
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||| ||||| ||||||| ||||   ||||||||||||||||||||||||||| ||||||||| |||  |||||||||| ||||| || |||||||    
29127927 ttcgatttccagggagaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaag 29128026  T
122 cc 123  Q
    ||    
29128027 cc 29128028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 34 - 121
Target Start/End: Original strand, 47471851 - 47471938
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||  |||  |||||||||| ||||| || |||||||    
47471851 ggggaacaatgcttggctagtgcgcatgcttctacgcatgagccgaattagtcgtccacctttggtgggtcggaaaccgatgcgaaag 47471938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 34 - 123
Target Start/End: Complemental strand, 47749192 - 47749103
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    |||||||||| |||| | |||||||||||||||||||| |||||||||||||||| |||  ||||| |||| ||||| || |||||||||    
47749192 ggggaacaactcttggccagtgcgcatgcctctacgcacgagccgaattagtcgcccacctttggtaggtcggaaaccgatgcgaaagcc 47749103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 24506746 - 24506659
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||  ||||||||||||| ||||| |||||||||||||||||| |  |||||||||||||  |||||||||| |||||    
24506746 ttcgattttcaggga-aacaacgcttgaccagtgcacatgcctctacgcatgagtcagattagtcgctcaccattggtgggtcggaaac 24506659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 30767346 - 30767258
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||| ||||||||||||| |||| | |||| ||||||||||||||| |||||| ||||||||| |||  |||||||||| |||||    
30767346 ttcgatttccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaac 30767258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 928605 - 928672
Alignment:
19 agattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    |||||||||| |||||||||||||| |||||| |||||||||||| ||||||| |||||| |||||||    
928605 agattcgattctcagggggaacaacacttgaccagtgcgcatgccgctacgcacgagccggattagtc 928672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 35 - 110
Target Start/End: Complemental strand, 3507619 - 3507544
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||| |||| | |||||||||||||||||||| |||||| |||||||||||||  |||||||||| |||||    
3507619 gggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgctcacctttggtgggtcggaaac 3507544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 33 - 92
Target Start/End: Complemental strand, 42412862 - 42412803
Alignment:
33 gggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    |||||||||||||||| | ||||| ||||||||||||||||||||| |||||||||||||    
42412862 gggggaacaacgcttggcaagtgcccatgcctctacgcatgagccggattagtcgctcac 42412803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 29135919 - 29135985
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    |||||||||  ||||||||||||| |||| | ||||||||||||||||||||||||||| |||||||    
29135919 gattcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtc 29135985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 32 - 110
Target Start/End: Original strand, 49198369 - 49198447
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||| |||| | ||||||||||||||||||||||||||| ||||||||  |||  ||||||| ||||||||    
49198369 agggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggatcagaaac 49198447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 32 - 110
Target Start/End: Complemental strand, 50405692 - 50405614
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||| ||||||||||||| |||||||||||||||||||| ||| || ||||||||| |||  |||||||||| |||||    
50405692 aggggaaacaacgcttgaccagtgcgcatgcctctacgcacgagtcggattagtcgcccaccattggtgggtcggaaac 50405614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 36 - 110
Target Start/End: Original strand, 54261248 - 54261322
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||| | ||||||||||||||||||||||||||| |||||||| ||||  || ||||||| |||||    
54261248 ggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaac 54261322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 6462420 - 6462485
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  ||||| |||||||||||| | ||||||||||||||||||||||||||| ||||||||    
6462420 ttcgattcacagggagaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcg 6462485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 27 - 88
Target Start/End: Original strand, 7648753 - 7648814
Alignment:
27 ttttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||||||| ||||| ||||||||| |||||||||| |||||| |||||||||    
7648753 ttttcagggggaacaacgtttgaccagtgcgcatacctctacgcacgagccggattagtcgc 7648814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 47219168 - 47219217
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||| ||||||||||||||||||||||||||||| ||||||||    
47219168 aacaacgcttggctagtgcgcatgcctctacgcatgagccggattagtcg 47219217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 34 - 110
Target Start/End: Complemental strand, 41630599 - 41630523
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||| | ||||||||||||||||| ||||||||| ||||||||| |||  ||||| |||| |||||    
41630599 ggggaacaacgcttgcccagtgcgcatgcctctacacatgagccggattagtcgcccacctttggttggtcggaaac 41630523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 38 - 110
Target Start/End: Complemental strand, 43330815 - 43330743
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||| |||||| |||||||||||||||||||| |||||| ||||||||| |||  ||||||||||| ||||    
43330815 aacaacacttgaccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcaaaaac 43330743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 45877462 - 45877550
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||| |||||| |||||| |||| | ||||| ||||||||||||||||||||| |||||||| ||||  ||| |||||| |||||    
45877462 ttcgatttccaggggaaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgttcaccattgatgggtcggaaac 45877550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 51683053 - 51682965
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  |||||||||||||||||||| ||||||||||||||| | || |||||| ||||||||| |||   ||||||||| |||||    
51683053 ttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctccacacgagccggattagtcgcccaccaatggtgggtcggaaac 51682965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 21 - 88
Target Start/End: Complemental strand, 2029367 - 2029300
Alignment:
21 attcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||| | |||||||||||  |||| ||||||||||||||||||||| | |||||||||    
2029367 attcgattttcaggagaaacaacgcttggttagtacgcatgcctctacgcatgagctggattagtcgc 2029300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 25 - 88
Target Start/End: Original strand, 10855395 - 10855458
Alignment:
25 gattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||| |||||||||||||||||| | ||| |||||||||||||||| || |||||||||||||    
10855395 gatttccagggggaacaacgcttggccagtacgcatgcctctacgcacgaaccgaattagtcgc 10855458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 32 - 87
Target Start/End: Original strand, 48342038 - 48342093
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||||| ||||||||||||||||||||||||| ||  ||||||||    
48342038 agggggaacaacgcttggctagtgcgcatgcctctacgcatgaaccagattagtcg 48342093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 104
Target Start/End: Original strand, 7328852 - 7328933
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    |||||||  ||||||||||||| |||| | ||||||||||||| ||||||||||||| ||||||||| |||  ||||||||||    
7328852 ttcgattcccagggggaacaacacttggccagtgcgcatgcct-tacgcatgagccggattagtcgcccacctttggtgggtc 7328933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 108
Target Start/End: Original strand, 40944891 - 40944976
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaa 108  Q
    |||||||  ||||||||||||| ||| || |||  ||||||||||||||||||| || |||||||||||||  ||||||||||||||    
40944891 ttcgattcccagggggaacaacacttaaccagtatgcatgcctctacgcatgag-cggattagtcgctcacctttggtgggtcagaa 40944976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 3755578 - 3755643
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  |||| ||||||||| ||||| |||||||||| |||||||||||||||| ||||||||    
3755578 ttcgattcccaggaggaacaacgtttgaccagtgcgcatgtctctacgcatgagccggattagtcg 3755643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 7310802 - 7310701
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  ||| ||||||||| |||| |  ||| ||||||||||||||| |||||| ||||||||||||   |||||||||| ||||| || |||||||    
7310802 ttcgattcccagtgggaacaacacttgcccggtgtgcatgcctctacgcacgagccggattagtcgctcatctttggtgggtcggaaaccgatgcgaaag 7310703  T
122 cc 123  Q
    ||    
7310702 cc 7310701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 15320194 - 15320295
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||||  ||| ||||||| | ||| | |||| ||||||||||||||| |||||| ||||||||| |||  |||||||||||||||| |  |||||||    
15320194 ttcgatttcgaggaggaacaatgattggccagtgtgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaag 15320293  T
122 cc 123  Q
    ||    
15320294 cc 15320295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 34 - 87
Target Start/End: Complemental strand, 26207888 - 26207835
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||| | |||| |||||||||||||||||||||| ||||||||    
26207888 ggggaacaacgcttgtccagtgtgcatgcctctacgcatgagccggattagtcg 26207835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 28572310 - 28572209
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  |||||| ||||||||||| | |||  ||||||||||||||| |||||| ||||||||| |||  |||||||||| ||||| |  |||||||    
28572310 ttcgattcccaggggaaacaacgcttggccagtatgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 28572211  T
122 cc 123  Q
    ||    
28572210 cc 28572209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 51060380 - 51060279
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||| |||||||||||||| ||||   ||||||||||||||||||||||| | | ||||||||  |||  |||||||||| ||||| |  |||||||    
51060380 ttcgattctcagggggaacaacacttggtcagtgcgcatgcctctacgcatgaactggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 51060281  T
122 cc 123  Q
    ||    
51060280 cc 51060279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 36 - 88
Target Start/End: Original strand, 39849093 - 39849145
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||||||| | |||| |||||||||||||||||||||| |||||||||    
39849093 ggaacaacgcttggccagtgtgcatgcctctacgcatgagccggattagtcgc 39849145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 54 - 110
Target Start/End: Original strand, 44064584 - 44064640
Alignment:
54 tgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||||||||| ||| |||||||||||||  |||||||||| |||||    
44064584 tgcgcatgcctctacgcatgaaccggattagtcgctcacctttggtgggtcggaaac 44064640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 49543527 - 49543615
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||| ||| ||||||||||| |||   |||| ||||||||||||||| |||||||||||||||| |||  || ||||||| |||||    
49543527 ttcgattctcatggggaacaacgtttggtcagtgtgcatgcctctacgcacgagccgaattagtcgcccacctttagtgggtcggaaac 49543615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 3136794 - 3136728
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||||| |||||| ||||   |||||||||||||||||||||||| || ||||||||    
3136794 gattcgattttcagggg-aacaacacttgggcagtgcgcatgcctctacgcatgagtcggattagtcg 3136728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 22909805 - 22909856
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||| | ||||||||||| | ||||||||||||||||||||||||    
22909805 ggaacaacgctaggctagtgcgcatacttctacgcatgagccgaattagtcg 22909856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 207 - 258
Target Start/End: Original strand, 24559441 - 24559492
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttctaacca 258  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||||||    
24559441 gttcgaaccccggacaccccacttattcactttaaaagtgaatttctaacca 24559492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 52 - 123
Target Start/End: Complemental strand, 49021272 - 49021201
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    ||||||||||||||||||||||||||| ||||||||  |||  |||||||||| ||||| |  |||||||||    
49021272 agtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagcc 49021201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 35 - 110
Target Start/End: Complemental strand, 55069765 - 55069690
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||| ||| | ||||| |||||||||||||| |||||| |||| ||||||||  |||||||||| |||||    
55069765 gggaacaacgtttggccagtgcacatgcctctacgcacgagccggattaatcgctcacctttggtgggtcggaaac 55069690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 34 - 88
Target Start/End: Complemental strand, 15795581 - 15795527
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||||   |||||||||||||||||||| |||| |||||||||||    
15795581 ggggaacaacgcttggtcagtgcgcatgcctctacgcacgagctgaattagtcgc 15795527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 24 - 110
Target Start/End: Complemental strand, 29762252 - 29762166
Alignment:
24 cgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||| ||||||| |||||| |||| | |||||||||||||||| |||||||| | ||||||||  |||  |||||||||| |||||    
29762252 cgattctcaggggcaacaacacttggccagtgcgcatgcctctatgcatgagctggattagtcgtccaccattggtgggtcggaaac 29762166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 53 - 123
Target Start/End: Complemental strand, 45402419 - 45402349
Alignment:
53 gtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    |||||||||||||||||||||||||| |||||||| ||||  || ||||||| ||||| || ||| |||||    
45402419 gtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaactgatgcgcaagcc 45402349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 92
Target Start/End: Original strand, 53649735 - 53649805
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    ||||||| |||||| ||||||| |||| | ||||||| || |||||||||||||||| |||||||| ||||    
53649735 ttcgattctcagggtgaacaacacttggccagtgcgcctgtctctacgcatgagccggattagtcgttcac 53649805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 103
Target Start/End: Original strand, 7650235 - 7650316
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggt 103  Q
    |||||||| ||||||||||||| |||| | ||| || ||| ||||||||| |||||| ||||||||| |||  |||||||||    
7650235 ttcgatttccagggggaacaacacttggccagtacgaatgtctctacgcacgagccggattagtcgcccacctttggtgggt 7650316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 85
Target Start/End: Original strand, 4638153 - 4638225
Alignment:
13 aatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagt 85  Q
    |||| ||| |||||||  |||| | ||||||||||||| ||||||||| |||||||||| |||||| ||||||    
4638153 aataataggttcgattcccaggagaaacaacgcttgaccagtgcgcatacctctacgcacgagccggattagt 4638225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 78
Target Start/End: Original strand, 10040576 - 10040620
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccg 78  Q
    ||||||||||||||| | |||||||||||||||||||| ||||||    
10040576 ggggaacaacgcttggccagtgcgcatgcctctacgcacgagccg 10040620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 101
Target Start/End: Original strand, 13893937 - 13894013
Alignment:
25 gattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgg 101  Q
    ||||| ||||||||||||||||||   | ||||||||||||||| || |||||| ||||||||| |||  |||||||    
13893937 gatttccagggggaacaacgcttggtcaatgcgcatgcctctacacacgagccggattagtcgcccacctttggtgg 13894013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 26590379 - 26590319
Alignment:
8 cgaagaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctac 68  Q
    ||||||||||| | ||||||| |||||||||||||||||||   |||| ||||||||||||    
26590379 cgaagaatattgggttcgattctcagggggaacaacgcttggtcagtgtgcatgcctctac 26590319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 44 - 88
Target Start/End: Complemental strand, 28538265 - 28538221
Alignment:
44 gcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||| ||||| ||||||||||||| ||||||||||||    
28538265 gcttgactagtgtgcatgtctctacgcatgagtcgaattagtcgc 28538221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 32 - 88
Target Start/End: Complemental strand, 32873638 - 32873582
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||| |||||||||||||| ||||| |||||||||||| |||||||  |||||||||    
32873638 agggagaacaacgcttgaccagtgcacatgcctctacgtatgagccagattagtcgc 32873582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 87
Target Start/End: Original strand, 33251683 - 33251735
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||| ||| | |||| |||||||||||||||||||||| ||||||||    
33251683 gggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcg 33251735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 76
Target Start/End: Complemental strand, 52364885 - 52364845
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagc 76  Q
    ||||||||||||||| |||||||||||||||||||| ||||    
52364885 ggaacaacgcttgaccagtgcgcatgcctctacgcacgagc 52364845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 87
Target Start/End: Original strand, 54237457 - 54237521
Alignment:
23 tcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||| ||||||| ||||   |||||||||| |||||||||||||||| || |||||    
54237457 tcgattttcagggagaacaacacttggtcagtgcgcatgtctctacgcatgagccggataagtcg 54237521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 34 - 101
Target Start/End: Original strand, 8164573 - 8164640
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgg 101  Q
    ||||||||||||||| | ||||||||||||| |||||| ||| || ||||||||| |||  |||||||    
8164573 ggggaacaacgcttggccagtgcgcatgcctttacgcacgagtcggattagtcgcccacctttggtgg 8164640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 9625035 - 9625082
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
9625035 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 9625082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 10959185 - 10959232
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
10959185 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 10959232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 19146966 - 19147057
Alignment:
19 agattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||||||| ||||||||||||| | |||| | || |||||| ||| |||| | ||||||||  |||  |||||||||| |||||    
19146966 agattcgattttcaggaggaacaacgcttggccagtgtgtatccctctatgcacgagctggattagtcgtccacctttggtgggtcggaaac 19147057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 27183724 - 27183677
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
27183724 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 27183677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 32 - 87
Target Start/End: Complemental strand, 35923712 - 35923657
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||| ||| | |||||||||||||||| ||| ||| |||||||||||    
35923712 agggggaacaacgtttggccagtgcgcatgcctctaagcacgagtcgaattagtcg 35923657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 38 - 92
Target Start/End: Original strand, 2668085 - 2668139
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    |||||| |||| | |||||||||||||||||||| |||| | |||||||||||||    
2668085 aacaacacttggccagtgcgcatgcctctacgcaagagctggattagtcgctcac 2668139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 75
Target Start/End: Complemental strand, 11687205 - 11687155
Alignment:
25 gattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgag 75  Q
    |||| ||||||||||||| ||||| | |||||||||||||||||| |||||    
11687205 gattctcagggggaacaatgcttggccagtgcgcatgcctctacgtatgag 11687155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 33 - 87
Target Start/End: Original strand, 25294979 - 25295033
Alignment:
33 gggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||| |||||| |||| | |||||||||||||||| |||||||||| ||||||||    
25294979 ggggaaacaacacttggccagtgcgcatgcctctatgcatgagccggattagtcg 25295033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 34 - 72
Target Start/End: Complemental strand, 45450534 - 45450496
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcat 72  Q
    ||||||||| ||||||| |||||||||||||||||||||    
45450534 ggggaacaatgcttgaccagtgcgcatgcctctacgcat 45450496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 8362601 - 8362650
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||| ||| | ||| |||||||||||||||||||||| |||||||||    
8362601 aacaacgtttggccagtccgcatgcctctacgcatgagccaaattagtcg 8362650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 75
Target Start/End: Original strand, 23511587 - 23511628
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgag 75  Q
    ||||| ||||| ||||| ||||||||||||||||||||||||    
23511587 ggggagcaacgtttgaccagtgcgcatgcctctacgcatgag 23511628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 71
Target Start/End: Original strand, 31072886 - 31072935
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgca 71  Q
    |||||||| ||||||||||||||||||   ||||| ||||||||||||||    
31072886 ttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgca 31072935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 34662418 - 34662353
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||| |||| |||| |||   ||| |||||| ||||| |||||||||||||||||||    
34662418 ttcgattttcaggaggaataacgtttggtcagtacgcatgtctctatgcatgagccgaattagtcg 34662353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 38 - 83
Target Start/End: Complemental strand, 37319972 - 37319927
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaatta 83  Q
    ||||||||||||| |||| ||||||||||||||| |||| ||||||    
37319972 aacaacgcttgacaagtgtgcatgcctctacgcacgagctgaatta 37319927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 34 - 86
Target Start/End: Original strand, 13367444 - 13367496
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    |||||||||||||||   |||| |||||||| ||||||||||||| |||||||    
13367444 ggggaacaacgcttggtcagtgtgcatgcctttacgcatgagccggattagtc 13367496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 16141396 - 16141352
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaattt 251  Q
    ||||||||||| ||||||||| |||||||  ||||||||||||||    
16141396 gttcgaactccagacaccccacttattcatcttaaaggtaaattt 16141352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 34 - 110
Target Start/End: Complemental strand, 26362054 - 26361978
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||| |||   |||| ||||||||||||||| |||||| ||||||||| |||  ||| |||||| |||||    
26362054 ggggaacaacgtttggtcagtgtgcatgcctctacgcacgagccggattagtcgcacacctttgatgggtcggaaac 26361978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 22 - 104
Target Start/End: Complemental strand, 155809 - 155727
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    |||||||  |||||||||||||||||| |||||||||||||||||||||| |||||| ||||||||| |||  ||||||||||    
155809 ttcgattcccagggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtc 155727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 49; Significance: 6e-19; HSPs: 74)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 3159567 - 3159479
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||| || |||||||||||||||||| | |||||||||||||||||||| |||||  |||||||||||||  |||||||||| |||||    
3159567 ttcgacttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccagattagtcgctcaccattggtgggtcggaaac 3159479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 22 - 122
Target Start/End: Original strand, 38075446 - 38075546
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||| ||||||| ||||||||||| | |||||||||||||||||||||||||||||||| | |  |||  |||||||||| ||||| || |||||||    
38075446 ttcgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattaattgtccacctttggtgggtcggaaaccgatgcgaaag 38075545  T
122 c 122  Q
    |    
38075546 c 38075546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 47078471 - 47078559
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  |||||||||||||||||| | ||||| |||||||||||||| |||||| |||||||||||||  |||||||||| |||||    
47078471 ttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgctcaccattggtgggtcggaaac 47078559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 35 - 110
Target Start/End: Complemental strand, 7246731 - 7246656
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||||| | ||||||||||||||||||||||||||| ||||||||| |||  |||||||||| |||||    
7246731 gggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaac 7246656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 12 - 110
Target Start/End: Original strand, 30317236 - 30317334
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||| || ||||||| |||| |||||||||||||| | ||| || ||||||||||||| |||||||||||||||| |||  |||||||||| |||||    
30317236 gaatatcaggttcgattctcagagggaacaacgcttggccagtacgaatgcctctacgcacgagccgaattagtcgcccacctttggtgggtcggaaac 30317334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 40780959 - 40780871
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||| ||| |||||||||||||||   ||||||||||||||||||||||||||| ||||||||  |||  |||||||||| |||||    
40780959 ttcgattctcaaggggaacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaac 40780871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 25 - 104
Target Start/End: Complemental strand, 5472943 - 5472864
Alignment:
25 gattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    |||| ||||||| ||||||||||| | |||||||||||||||||||| |||||| ||||||||| |||  ||||||||||    
5472943 gattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtc 5472864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 22 - 101
Target Start/End: Complemental strand, 20532507 - 20532428
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgg 101  Q
    |||||||| |||| ||||||||||||| | ||||||||||||||||||||||||||| || |||||| |||  |||||||    
20532507 ttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggataagtcgcccacctttggtgg 20532428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 31 - 110
Target Start/End: Original strand, 38166049 - 38166128
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||||||||| | |||||||||| ||||||||| |||||| ||||||||| |||  |||||||||| |||||    
38166049 cagggggaacaacgcttggccagtgcgcatggctctacgcacgagccggattagtcgcccacctttggtgggtcggaaac 38166128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 34 - 88
Target Start/End: Original strand, 17080068 - 17080122
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||||||||| | ||||||||||||||||||||||||||| |||||||||    
17080068 ggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgc 17080122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 25 - 87
Target Start/End: Original strand, 20354653 - 20354715
Alignment:
25 gattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||| ||||| |||||||||||| |||||||||||||||||||||||||| || ||||||||    
20354653 gatttccagggagaacaacgcttggctagtgcgcatgcctctacgcatgagtcggattagtcg 20354715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 1446839 - 1446904
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  ||||||||||||| |||| | ||||||||||||||||||||||||||| ||||||||    
1446839 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcg 1446904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 4738631 - 4738732
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||| |||| ||||||||||||  | |||||||||| |||||||||||||| ||||||||||  |||  |||||||||| ||||| |  |||||||    
4738631 ttcgatttccaggaggaacaacgctttgccagtgcgcatgtctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgcgaaag 4738730  T
122 cc 123  Q
    ||    
4738731 cc 4738732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 10 - 87
Target Start/End: Original strand, 16450301 - 16450378
Alignment:
10 aagaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||| | |||||||  |||||||||||||||||| | ||||| ||||||||||||||||||||  ||||||||    
16450301 aagaatattgggttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcatgagccagattagtcg 16450378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 29895800 - 29895865
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  ||||||||||||| |||| | ||||||||||||||||||||||||||| ||||||||    
29895800 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcg 29895865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 52 - 121
Target Start/End: Original strand, 31588729 - 31588798
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||||| |||||||||||||||| |||||||||||||| ||||||| || ||||| || |||||||    
31588729 agtgcgcatgtctctacgcatgagccggattagtcgctcacttttggtggatcggaaaccgatgcgaaag 31588798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 35359749 - 35359850
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||| ||||||||||||||| ||||| |||||||||||||| |||||| ||  | ||||||||| |||| | |||||||| ||||| |  |||||||    
35359749 ttcgattctcagggggaacaacgtttgaccagtgcgcatgcctcaacgcataagttggattagtcgcccactataggtgggtcggaaaccggtgcgaaag 35359848  T
122 cc 123  Q
    ||    
35359849 cc 35359850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 31 - 92
Target Start/End: Complemental strand, 42722666 - 42722605
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    |||| ||||||||||||| | ||||||||||||||||||||||||||| |||||||| ||||    
42722666 caggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcac 42722605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 35 - 123
Target Start/End: Complemental strand, 36262852 - 36262764
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaagcc 123  Q
    |||||||||||||| | ||||| |||||||||||||| ||| || ||||||||| |||  ||||||||||||||||  | |||||||||    
36262852 gggaacaacgcttggccagtgcacatgcctctacgcacgagtcggattagtcgcccacctttggtgggtcagaaaccaatgcgaaagcc 36262764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 40272429 - 40272341
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||| || ||||||||||||||| | ||||||||||||||||||||| || || ||| |||| ||||  |||||||||| |||||    
40272429 ttcgatttccatggggaacaacgcttggccagtgcgcatgcctctacgcataagtcggatttgtcgttcaccattggtgggtcggaaac 40272341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 7 - 103
Target Start/End: Complemental strand, 48317388 - 48317292
Alignment:
7 tcgaagaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggt 103  Q
    ||||| |||| | ||||||||||||||| |||||||||||||   |||| | ||||||||||||| |||||| ||||||||| ||| |||| |||||    
48317388 tcgaaaaatactggattcgattttcaggaggaacaacgcttggtcagtgtgtatgcctctacgcacgagccggattagtcgcccaccgttgatgggt 48317292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 55921047 - 55921135
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  ||||||||||||| ||||   |||||||||||||||||| |||||||| |||| ||||||||  |||||||||| |||||    
55921047 ttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgtatgagccggattaatcgctcacctttggtgggtcggaaac 55921135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 20421786 - 20421841
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagcc 77  Q
    |||||||| ||||||||||||| |||| | ||||||||||||||||||||||||||    
20421786 ttcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagcc 20421841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 34 - 109
Target Start/End: Complemental strand, 49260751 - 49260676
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaa 109  Q
    ||||||||||||||| | |||||||||||||||||||| |||||| ||||||||  |||  |||||||||| ||||    
49260751 ggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgaccacctttggtgggtcggaaa 49260676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 34 - 87
Target Start/End: Complemental strand, 8064884 - 8064831
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||| ||| |||||| ||||||||||||||||||||||||||| ||||||||    
8064884 ggggaataacacttgaccagtgcgcatgcctctacgcatgagccggattagtcg 8064831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 103
Target Start/End: Original strand, 14124029 - 14124110
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggt 103  Q
    |||||||  |||||||||||||  ||| | ||||||||||||||||| || |||||| |||||||||||||  |||||||||    
14124029 ttcgattcccagggggaacaacatttggccagtgcgcatgcctctacacacgagccggattagtcgctcaccattggtgggt 14124110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 20128322 - 20128423
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    ||||||| ||||||||||||| ||||| | ||||||||||||| |||||| ||||   ||||||||  |||  |||||||||||||||| |  |||||||    
20128322 ttcgattctcagggggaacaatgcttggccagtgcgcatgcctttacgcacgagctagattagtcgtccaccattggtgggtcagaaaccggtgcgaaag 20128421  T
122 cc 123  Q
    ||    
20128422 cc 20128423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 22 - 87
Target Start/End: Complemental strand, 36145313 - 36145248
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  |||||| ||||||||||||  ||||||||||||||||| ||||||||| ||||||||    
36145313 ttcgattcccaggggaaacaacgcttgatcagtgcgcatgcctctacacatgagccggattagtcg 36145248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 104
Target Start/End: Complemental strand, 1940872 - 1940793
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    |||||||  ||||||||||||||||||    ||||||||||||||||||| |||||| ||||||||| |||  ||||||||||    
1940872 ttcgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtc 1940793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 11 - 87
Target Start/End: Complemental strand, 2686564 - 2686488
Alignment:
11 agaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||| |||||||||||||||||| |||||| |||||| | | |  ||| |||||| ||||||||||||||||||    
2686564 agaatatcagattcgattttcaggggaaacaacacttgaccactacatatgtctctacacatgagccgaattagtcg 2686488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 46108716 - 46108792
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||  ||| ||||||||||||||||||||||||||||  ||||||||  |||| ||| |||||| |||||    
46108716 ggggaacaacatttggctagtgcgcatgcctctacgcatgagccagattagtcgtccacttttgatgggtcggaaac 46108792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 198 - 254
Target Start/End: Original strand, 46799450 - 46799506
Alignment:
198 agagtcgaagttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||| ||| |||||||| ||||||||||||||||||||||||||| || ||||||||    
46799450 agagccgaggttcgaaccccggacaccccatttattcactttaaaagtgaatttcta 46799506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 122
Target Start/End: Original strand, 52950095 - 52950195
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagaagcgaaag 121  Q
    |||||||  |||||||||||||||||| | |||||||||| |||||| ||||| ||  ||||||||  |||  |||||||||| ||||| || |||||||    
52950095 ttcgattcccagggggaacaacgcttggccagtgcgcatgactctacacatgaaccagattagtcgtccacctttggtgggtcggaaaccgatgcgaaag 52950194  T
122 c 122  Q
    |    
52950195 c 52950195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 22 - 85
Target Start/End: Original strand, 29588749 - 29588812
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagt 85  Q
    |||||||  |||||| ||||| ||||| |||||||||||||||||||||| |||||| ||||||    
29588749 ttcgattcccaggggaaacaaagcttggctagtgcgcatgcctctacgcacgagccggattagt 29588812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 36954189 - 36954236
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| ||||||||||||||||||||||||||| || ||||||||    
36954189 gttcgaaccccggacaccccatttattcactttaaaagtgaatttcta 36954236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 207 - 258
Target Start/End: Complemental strand, 52330952 - 52330901
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttctaacca 258  Q
    ||||||||||||||||||||| |||||||||||||| || |||||| |||||    
52330952 gttcgaactccggacaccccacttattcactttaaaagtgaatttccaacca 52330901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 110
Target Start/End: Original strand, 2559318 - 2559408
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||  ||| ||||||||||||| | ||||||||||||||||||||  ||||| |||| |||  |||  |||||||||| |||||    
2559318 gattcgatttctaggaggaacaacgcttggccagtgcgcatgcctctacgcacaagccggattactcgtccacctttggtgggtcggaaac 2559408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 32 - 110
Target Start/End: Original strand, 8889045 - 8889123
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||| ||||   |||||||||| |||||||||||||||| ||||||||  |||  |||||||||| |||||    
8889045 agggggaacaacacttgggcagtgcgcatggctctacgcatgagccggattagtcgtccacctttggtgggtcggaaac 8889123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 12703643 - 12703577
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||| ||| |||||||||||||||| |||| | ||| |||||||||| ||||| |||||||||    
12703643 ttcgatttccagtgggaacaacgcttgaccagtgtgtatgtctctacgcataagccggattagtcgc 12703577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 14859302 - 14859368
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    ||||||||||||||| ||||||| | ||||| |||||||||| ||||||||| |||||  |||||||    
14859302 gattcgattttcaggaggaacaatgtttgaccagtgcgcatgtctctacgcacgagccagattagtc 14859368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 34 - 76
Target Start/End: Complemental strand, 24850713 - 24850671
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagc 76  Q
    |||||||||| |||||| |||||||||||||||||||||||||    
24850713 ggggaacaacacttgaccagtgcgcatgcctctacgcatgagc 24850671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 43468360 - 43468426
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||  |||||||||||||||||| | ||||| |||  |||||||||||||||| |||||||||    
43468360 ttcgattcccagggggaacaacgcttggccagtgcacatttctctacgcatgagccggattagtcgc 43468426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 92
Target Start/End: Original strand, 53599073 - 53599143
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    |||||||  |||| ||||||||| ||| | ||||||||||||||||||||||||||| |||| ||| ||||    
53599073 ttcgattcccaggaggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattaatcgttcac 53599143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 31 - 92
Target Start/End: Complemental strand, 3574535 - 3574474
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    ||||| ||||||| |||| | |||||||||||||||||||| ||| || |||||||||||||    
3574535 cagggagaacaacacttggccagtgcgcatgcctctacgcacgagtcggattagtcgctcac 3574474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 6779224 - 6779289
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||  ||||||||||||| | || | |||||||||||||||| |||||||||| ||||||||    
6779224 ttcgattcccagggggaacaacacctggccagtgcgcatgcctctatgcatgagccggattagtcg 6779289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 52 - 109
Target Start/End: Original strand, 14567282 - 14567339
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaa 109  Q
    |||||||||||||||||||| |||||| ||||||||||| |  |||||||||| ||||    
14567282 agtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaa 14567339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 87
Target Start/End: Original strand, 3507296 - 3507348
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||||||| ||||||||| ||||||||| || |||||| ||||||||    
3507296 gggaacaacgcttggctagtgcgcgtgcctctacacacgagccggattagtcg 3507348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 88
Target Start/End: Complemental strand, 15840003 - 15839967
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||||||||||||||||||||| |||||||||    
15840003 agtgcgcatgcctctacgcatgagccggattagtcgc 15839967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 16645131 - 16645219
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||||||||  |||||||||||| | |||| |||||||||||| |||||| |  ||||||||| |||   ||||||||| |||||    
16645131 ttcgattttcaggaagaacaacgcttggccagtgtgcatgcctctacacatgagtctgattagtcgcccacctgtggtgggtcggaaac 16645219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 92
Target Start/End: Original strand, 38168284 - 38168339
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcac 92  Q
    ||||||||||||| | ||||| ||||||||||||||||||||| |||||||| ||||    
38168284 ggaacaacgcttggccagtgc-catgcctctacgcatgagccggattagtcgttcac 38168339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 8690266 - 8690313
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
8690266 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 8690313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 9693014 - 9693061
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
9693014 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 9693061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 10541029 - 10541084
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagcc 77  Q
    |||||||| |||||| ||||||||||| | |||| ||||||||||||||| |||||    
10541029 ttcgatttccaggggaaacaacgcttggccagtgtgcatgcctctacgcacgagcc 10541084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 14149845 - 14149892
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
14149845 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 14149892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 28520774 - 28520727
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
28520774 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 28520727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 43458624 - 43458691
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||||  |||| |||| |||||||| | |||||||||||||||||| | |||||| ||||||||    
43458624 gattcgattcccaggaggaagaacgcttggccagtgcgcatgcctctacggacgagccggattagtcg 43458691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 22 - 85
Target Start/End: Complemental strand, 48015171 - 48015108
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagt 85  Q
    |||||||  ||| |||||||||||||| | |||||||| ||||||||||| |||||| ||||||    
48015171 ttcgattcccagtgggaacaacgcttggccagtgcgcaagcctctacgcacgagccggattagt 48015108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 48968253 - 48968206
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| |||||||||||| |||||||||||||| || ||||||||    
48968253 gttcgaaccccggacaccccacttattcactttaaaagtgaatttcta 48968206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 13 - 88
Target Start/End: Complemental strand, 49952253 - 49952178
Alignment:
13 aatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||| || |||||||||  | ||||||| |||   |||||||| |||||||||||||||||| |||||||||    
49952253 aatattaggtttgattttcagaagaaacaacgtttggtcagtgcgcacgcctctacgcatgagccggattagtcgc 49952178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 21 - 88
Target Start/End: Complemental strand, 55005405 - 55005338
Alignment:
21 attcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||||  |||||| ||||||||||||| | ||||||||||||||||||  || || |||||||||    
55005405 attcgattcgcaggggaaacaacgcttgaccattgcgcatgcctctacgcacaagtcggattagtcgc 55005338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 208 - 242
Target Start/End: Complemental strand, 11084294 - 11084260
Alignment:
208 ttcgaactccggacaccccatttattcactttaaa 242  Q
    ||||||||| |||||||||||||||||||||||||    
11084294 ttcgaactcgggacaccccatttattcactttaaa 11084260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 207 - 253
Target Start/End: Complemental strand, 22096434 - 22096388
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttct 253  Q
    ||||||||||||||||||||| ||||||| ||| ||||| |||||||    
22096434 gttcgaactccggacaccccacttattcatttttaaggtgaatttct 22096388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 207 - 261
Target Start/End: Original strand, 40150525 - 40150579
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttctaaccatta 261  Q
    |||||||| ||||||||| || |||||||||||||| || |||||||| ||||||    
40150525 gttcgaaccccggacacctcacttattcactttaaaagtgaatttctatccatta 40150579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 41162980 - 41162914
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||| ||| ||||||||| |||| | ||||  ||||| |||| ||||||||||||||||||||    
41162980 ttcgatttccagagggaacaacacttggccagtgtacatgcttctatgcatgagccgaattagtcgc 41162914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 56 - 110
Target Start/End: Original strand, 54946296 - 54946350
Alignment:
56 cgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||||||||||| ||||||||| ||   |||||||||| |||||    
54946296 cgcatgcctctacgcatgagccggattagtcgcccatcattggtgggtcggaaac 54946350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 110
Target Start/End: Original strand, 4736645 - 4736698
Alignment:
57 gcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||| |  ||||||||||||||| ||| ||||||||||| |||||    
4736645 gcatgcctctacgtacaagccgaattagtcgcccaccgttggtgggtcggaaac 4736698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 87
Target Start/End: Complemental strand, 6032721 - 6032676
Alignment:
42 acgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||| ||||| |||||||||||| |||||||| ||||||||    
6032721 acgcttgaccagtgctcatgcctctacgaatgagccggattagtcg 6032676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 86
Target Start/End: Original strand, 15829715 - 15829776
Alignment:
25 gattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtc 86  Q
    |||||||||||| | |||| |||| | ||||||||||| |||| |||||||||| |||||||    
15829715 gattttcaggggaatcaacacttggccagtgcgcatgcttctaggcatgagccggattagtc 15829776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 71
Target Start/End: Original strand, 21429314 - 21429363
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgca 71  Q
    ||||||||| ||||||||||||| ||  | ||||||||||||||||||||    
21429314 ttcgatttttagggggaacaacgtttagccagtgcgcatgcctctacgca 21429363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 83
Target Start/End: Complemental strand, 26480035 - 26479986
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaatta 83  Q
    |||||| ||| |||| | ||| ||||||||||||||||||||||||||||    
26480035 ggggaataacacttggccagtacgcatgcctctacgcatgagccgaatta 26479986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 71
Target Start/End: Original strand, 33647734 - 33647783
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgca 71  Q
    |||||||| ||||| |||||||||||||| ||||| ||| ||||||||||    
33647734 ttcgatttccagggagaacaacgcttgaccagtgcacattcctctacgca 33647783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 17946500 - 17946555
Alignment:
19 agattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgag 75  Q
    |||||||||||||||||| |||||  |||||| ||||||||||| ||||| ||||||    
17946500 agattcgattttcagggg-aacaattcttgaccagtgcgcatgcttctacacatgag 17946555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 190 - 242
Target Start/End: Complemental strand, 21365562 - 21365511
Alignment:
190 atatatagagagtcgaagttcgaactccggacaccccatttattcactttaaa 242  Q
    ||||||||| ||||| |||| |||||||||||||||||  |||||||||||||    
21365562 atatataga-agtcggagtttgaactccggacaccccacctattcactttaaa 21365511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 31 - 110
Target Start/End: Original strand, 27248450 - 27248527
Alignment:
31 cagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||| ||||||||||||| | ||  |||||||||||||||| |||||  ||||||||| |||  ||||| ||||||||||    
27248450 caggaggaacaacgcttggccag--cgcatgcctctacgcaggagccagattagtcgcccacctttggtaggtcagaaac 27248527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0316 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0316
Description:

Target: scaffold0316; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 22 - 104
Target Start/End: Complemental strand, 1712 - 1630
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    |||||||| |||||||||||||| ||  | |||||||||||||||||||||||||| |||||||||| |||  ||||||||||    
1712 ttcgatttccagggggaacaacgattagccagtgcgcatgcctctacgcatgagccaaattagtcgcccacctttggtgggtc 1630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0209 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: scaffold0209
Description:

Target: scaffold0209; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 35 - 88
Target Start/End: Original strand, 12597 - 12650
Alignment:
35 gggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||||||||||| |||||||||||||||||||||||| || |||||||||    
12597 gggaacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgc 12650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0086 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: scaffold0086
Description:

Target: scaffold0086; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 26194 - 26259
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    |||||||| |||||||||||||||||| | |||| ||||||||||||||| |||||| ||||||||    
26194 ttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacgcacgagccggattagtcg 26259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0384 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0384
Description:

Target: scaffold0384; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 5984 - 6071
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||| |||||||| ||||||||| | ||||| |||||||||||||||||| |||||||||||  |||  |||||||||| |||||    
5984 ttcgatttccaggggga-caacgcttggccagtgcacatgcctctacgcatgagacgaattagtcgtccaccattggtgggtcggaaac 6071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Complemental strand, 8799 - 8711
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  |||||||||||||||||| | ||||||| ||||||||||||||||| | ||||||||  |||  |||||||||| |||||    
8799 ttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaac 8711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 581 - 669
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||||  ||||||||||||| |||||  |||| ||||||||||||| |||||||  |||||||||||||  |||||||||| |||||    
581 ttcgattcgcagggggaacaacacttgatcagtgtgcatgcctctacgtatgagccagattagtcgctcacctttggtgggtcggaaac 669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 32 - 87
Target Start/End: Original strand, 319443 - 319498
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||||| | ||||||||| |||||| |||||||| | ||||||||    
319443 agggggaacaacgcttggccagtgcgcatccctctatgcatgagctggattagtcg 319498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0155 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0155
Description:

Target: scaffold0155; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 32 - 87
Target Start/End: Original strand, 19276 - 19331
Alignment:
32 agggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcg 87  Q
    ||||||||||||||||| ||||||||||  ||||||||||||||||| ||||||||    
19276 agggggaacaacgcttggctagtgcgcagacctctacgcatgagccggattagtcg 19331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 34 - 93
Target Start/End: Complemental strand, 65238 - 65179
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcact 93  Q
    ||||||||||||||| | |||||||||| |||||||||||||| | ||||||||||||||    
65238 ggggaacaacgcttggccagtgcgcatgtctctacgcatgagctggattagtcgctcact 65179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 72643 - 72709
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||| || ||||||||||||||||| |||||||||||||| | |||| ||||| |||||||||    
72643 ttcgatttccaaggggaacaacgcttgaccagtgcgcatgcctcaaagcataagccggattagtcgc 72709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 110
Target Start/End: Original strand, 149396 - 149484
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||| ||||||||||||||||||||| |||| ||||||||||||| | |||    ||||||||| |||   |||||||||||||||    
149396 ttcgattctcagggggaacaacgcttgaccagtgtgcatgcctctacgtacgaggtagattagtcgcccaccaatggtgggtcagaaac 149484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 104
Target Start/End: Original strand, 68528 - 68607
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtc 104  Q
    |||||||  ||||||||||||||||||    ||||||||||||||||||| |||||| ||||||||| |||  ||||||||||    
68528 ttcgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtc 68607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0308 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0308
Description:

Target: scaffold0308; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 7128 - 7175
Alignment:
207 gttcgaactccggacaccccatttattcactttaaaggtaaatttcta 254  Q
    |||||||| ||||||||||||||||||||||||||| || ||||||||    
7128 gttcgaaccccggacaccccatttattcactttaaaagtgaatttcta 7175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 36 - 110
Target Start/End: Original strand, 12695 - 12769
Alignment:
36 ggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||| | |||| ||||||||||||||| || ||| ||||||||| |||  ||| ||||||||||||    
12695 ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacctttgatgggtcagaaac 12769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0116 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0116
Description:

Target: scaffold0116; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 110
Target Start/End: Original strand, 17399 - 17489
Alignment:
20 gattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||| ||||||| || || ||||||| ||||||||||| ||||| || |||||| ||||||||| |||  ||| |||||| |||||    
17399 gattcgattctcaggggaaaaaatgcttgaccagtgcgcatgcttctacacacgagccggattagtcgcccaccattgatgggtcggaaac 17489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 52 - 110
Target Start/End: Complemental strand, 42900 - 42842
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    ||||||||||||||||| ||||||||| ||||||||| |||  |||||||||| |||||    
42900 agtgcgcatgcctctacacatgagccggattagtcgcccacctttggtgggtcggaaac 42842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 88
Target Start/End: Complemental strand, 95063 - 95013
Alignment:
38 aacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||| ||||| ||||||||||||| ||||||||||||| |||||||||    
95063 aacaacgtttgaccagtgcgcatgcctttacgcatgagccggattagtcgc 95013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 34 - 110
Target Start/End: Complemental strand, 7921 - 7845
Alignment:
34 ggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaac 110  Q
    |||||| ||| |||| | ||||||||||||||||||||| ||| | ||||||||| |||  ||||||| || |||||    
7921 ggggaaaaacacttggccagtgcgcatgcctctacgcattagctggattagtcgcccacctttggtggatcggaaac 7845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 12 - 121
Target Start/End: Original strand, 16880 - 16989
Alignment:
12 gaatattagattcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaaca 111  Q
    ||||||| | ||| ||| ||||||| |||||||||||   |||||| ||| ||||||||| |||||  |||||||||||||  |||||||||  |||||     
16880 gaatattgggttcaattctcaggggaaacaacgcttggtcagtgcgtatgtctctacgcacgagccagattagtcgctcacctttggtgggttggaaacc 16979  T
112 gaagcgaaag 121  Q
    || |||||||    
16980 gatgcgaaag 16989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 52 - 109
Target Start/End: Complemental strand, 250093 - 250036
Alignment:
52 agtgcgcatgcctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaa 109  Q
    |||||||||||||||||||| |||||| ||||||||||| |  |||||||||| ||||    
250093 agtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaa 250036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 271172 - 271106
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    |||||||  ||||||||||||||||||   |||||||||| ||||||||| ||||||  ||||||||    
271172 ttcgattcccagggggaacaacgcttggtcagtgcgcatgtctctacgcacgagccgggttagtcgc 271106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 41055 - 41121
Alignment:
22 ttcgattttcagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccgaattagtcgc 88  Q
    ||||||| ||| |||||||||| ||||   |||| ||||||||||||||| |||||| |||||||||    
41055 ttcgattctcaaggggaacaacacttggtcagtgtgcatgcctctacgcacgagccggattagtcgc 41121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0372 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0372
Description:

Target: scaffold0372; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 190 - 242
Target Start/End: Complemental strand, 10086 - 10035
Alignment:
190 atatatagagagtcgaagttcgaactccggacaccccatttattcactttaaa 242  Q
    ||||||||| ||||| |||| |||||||||||||||||  |||||||||||||    
10086 atatataga-agtcggagtttgaactccggacaccccacctattcactttaaa 10035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University