View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_high_11 (Length: 337)
Name: NF1883_high_11
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 44451601 - 44451920
Alignment:
| Q |
1 |
tcgactattggttcatcttaggcttatgcaactacgcacagatcttgtgttcttgtgtttccatgattgtctcttctgaccggtttgattttaaatttat |
100 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44451601 |
tcgacaattggttcatcttaggcttctgcaactacgcacagatcttttgttcttgtgtttccatgattgtctcttctgaccagtttgattttaaatttat |
44451700 |
T |
|
| Q |
101 |
ttcttgccttgttctcgcccaagaacaagattcttggtagttgtcttcttcataaatgtgttcttgtggctgtgacaaaaatcctttttagagaaggttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44451701 |
ttcttgccttgttctcgcccaagaacaagattcttggtggttgtcttcttcataaatgtgttcttgtggctgtgac-aaaatcctttttagagaaggttg |
44451799 |
T |
|
| Q |
201 |
tgcctccaacttgttcgactcacccaaaactcgtaggttagtgttctctccctccattgttggcacctcgtaacaaacaccgtttccctctctaattgtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44451800 |
tgcctccaacttgttcgactcacccaaaactcgtaggttagtgttctctccctccattgttggcacctcgtaacaaccaccgtttccctctctaattgtt |
44451899 |
T |
|
| Q |
301 |
ctgatcagatctgtggaaaat |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44451900 |
ctgatcagatctgtggaaaat |
44451920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University