View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_high_25 (Length: 242)
Name: NF1883_high_25
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883_high_25 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 28461106 - 28460878
Alignment:
| Q |
20 |
agacctgaactacaataactaattgaacaactaactctaaccaatgcaactaaccannnnnnnnnn----caagaagcagttcattgaatttgacacaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
28461106 |
agacctgaactacaataactaattgaacaactaactctaaccaatgcaactaaccattttttttcttcttcaagaagcagtttatcgaatttgacacaaa |
28461007 |
T |
 |
| Q |
116 |
agagaattaaacatgaaaatagaggagcaca----cctcaaggttcaagccaa-cactattagactaggctaccatctaatattaactaaccctaattat |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28461006 |
agagaattaaacatgaaaatagaagagcacatgtacctcaaggttcaagccaaacactattagactaggctaccatctaatattaactaaccctaattat |
28460907 |
T |
 |
| Q |
211 |
cttaacaataatagcaccgtgaatttaatact |
242 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |
|
|
| T |
28460906 |
cttaac---aatagcaccgtgaatttaatact |
28460878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University