View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_high_26 (Length: 242)
Name: NF1883_high_26
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 85 - 227
Target Start/End: Original strand, 4972964 - 4973096
Alignment:
| Q |
85 |
gtgattgcagtttgtaaaattgatgtgagaggtacggcaagtgactttattcattacctaaagcagtgcaacgagggatagggagggatagggtgaagta |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4972964 |
gtgattgcagtttgtaaaattgatgtgagaggtacggcaagtgactttattcattacctaaagcagtgcaac----------gagggatagggtgaagta |
4973053 |
T |
 |
| Q |
185 |
gaagggaaatgacgcccagacatttaacatggccctaggaagg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4973054 |
gaagggaaatgacgcccagacatttaacatggccctatgaagg |
4973096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University