View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_low_15 (Length: 308)
Name: NF1883_low_15
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 13 - 292
Target Start/End: Original strand, 37887531 - 37887804
Alignment:
| Q |
13 |
aaaatcatggaaaagggcaggaacaagaagagaccggttaagctctccctatcggagatcgaagcagcaaaatttctcgtacaactcagcagcggagatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37887531 |
aaaatcatggaaaagggcaggaacaagaagaggccggttaagctctccctatcggagatcgaagcagcaaaatttctcgtacaactcagcagcggagatt |
37887630 |
T |
 |
| Q |
113 |
tcgaagaagatcaaaacagcaataacaacagcaatagcaatagctatagcgtgagtcacaacaaggttgattccggtggtgatgctgtatcatcatctac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37887631 |
tcgaagaagatcaaaacagcaataacaa------tagcaatagctatagcgtgagtcacaacaaggttgattccggtggtgatgttgtatcatcatctac |
37887724 |
T |
 |
| Q |
213 |
tgttttgtcagattctgaaagttgcgttgcaagaacaaataaaaggtatcgttacgttaatattgatgagttatatagag |
292 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37887725 |
tgttttgtcagattctgaaagttgctttgcaagaacaaataagaggtatcgttacgttaatattgatgagttatatagag |
37887804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University