View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_low_17 (Length: 294)
Name: NF1883_low_17
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 12 - 277
Target Start/End: Complemental strand, 185656 - 185391
Alignment:
| Q |
12 |
atgaaagaaacataaatggagaatagccaggggaaggaaggtagttacttgttcttaatctcagctgccatagttaagaaagcctgctcgacattgatgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
185656 |
atgaaagaaacataaatggagaatagccatgggaaggaaggtagttacttgttcttaatctcagctgccatagttaagaaagcctgctcgacattgatgg |
185557 |
T |
 |
| Q |
112 |
agtctttagcacttgtctcaaggaaagggataccaagctcatccgcaaatgccttggcagtgtgggtatgaacaagcttgttgtcggtgagatcacattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
185556 |
agtctttagcacttgtctcaaggaaagggataccaagctcatccgcaaatgccttggcagtgtgggtatgaacaagcttgttgtcggtgagatcacattt |
185457 |
T |
 |
| Q |
212 |
attcccaacaagaagcttggagacagagtgattagcatatctatcaatttcatgtaaccattgttt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
185456 |
attcccaacaagaagcttggagacagagtgattagcatatctatcaatttcatgtaaccactgttt |
185391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 53 - 192
Target Start/End: Original strand, 4439262 - 4439401
Alignment:
| Q |
53 |
tagttacttgttcttaatctcagctgccatagttaagaaagcctgctcgacattgatggagtctttagcacttgtctcaaggaaagggataccaagctca |
152 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4439262 |
tagttacttgttcttaatctcggctgccatagttaagaaagcctgctccacattgatggagtctttagcacttgtctcaaggaaagggataccaagctca |
4439361 |
T |
 |
| Q |
153 |
tccgcaaatgccttggcagtgtgggtatgaacaagcttgt |
192 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4439362 |
tccgcaaatgccttggcagtgtgggtttgaacaagcttgt |
4439401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University