View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_low_19 (Length: 292)
Name: NF1883_low_19
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 10 - 200
Target Start/End: Original strand, 44451162 - 44451352
Alignment:
| Q |
10 |
attattctactcagaatggcactgtttataaagattatgttaggaggatctctggtaagatcttggtcagaaaggggatttattcgcccctgaagtttta |
109 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44451162 |
attactctactcagaatggcattgtttataaagattatgttaggaggatctctggtaagatcttggccagaaaggggatttattcgcccctgaagtttta |
44451261 |
T |
 |
| Q |
110 |
tcaatcacaacaaaagaattacacaaaagagaactatcttctttcacactggaaattccagtttagctaagcaatatttatagaaggttgg |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44451262 |
tcgatcacaacaaaagaattacacaaaagagaactatcttctttcacaccggaaattccagtttagctaagcaatatttatagaaggttgg |
44451352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University