View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_low_20 (Length: 280)
Name: NF1883_low_20
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883_low_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 19 - 280
Target Start/End: Complemental strand, 25375369 - 25375108
Alignment:
| Q |
19 |
acttggactcttggagaaggaggttaaaggaagaaagatttaaccattagccaacaatttctcatgaaacattttattgcattaaatttctcatttaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25375369 |
acttggactcttggagaaggaggttaaaggaagaaagatttaaccattagccaacaatttctcatgaaacattttattgcattaaatttctcatttaatg |
25375270 |
T |
 |
| Q |
119 |
ccttcaccaatatcttttccataatagttacaaagaagaaacagtttctgtgtcattttaatttaatgccaccgtctatctttgattctcatgttcttgt |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25375269 |
ccttcaccaatattttttccataatagttacaaagaagaaacagtttctgtgtcattttaatttaatgccaccgtctatctttgattctcatgttcttgt |
25375170 |
T |
 |
| Q |
219 |
ctgcattgcaaccacctttcaacactctcctttcatctatctttttcagttttagatttcct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25375169 |
ctgcattgcaaccacctttcaacactctcctttcatctatctttttcagttttagatttcct |
25375108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University