View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883_low_24 (Length: 249)

Name: NF1883_low_24
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883_low_24
NF1883_low_24
[»] chr1 (3 HSPs)
chr1 (140-249)||(15593484-15593592)
chr1 (76-132)||(15593324-15593380)
chr1 (12-55)||(15593256-15593299)


Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 140 - 249
Target Start/End: Original strand, 15593484 - 15593592
Alignment:
140 tgctagtatattgggatttacaggctttgtagttgcttgaattggaaacttatagtctgccgcattgataggaaagttgattaatcaagacctatgtagc 239  Q
    ||||||||  |||| ||||||||||||||||||| |||||||||||| |||||||||| || ||||||||||||||||||| ||||||||||||||||||    
15593484 tgctagtaagttggaatttacaggctttgtagttacttgaattggaa-cttatagtctcccacattgataggaaagttgatgaatcaagacctatgtagc 15593582  T
240 actgacacga 249  Q
    ||||||||||    
15593583 actgacacga 15593592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 132
Target Start/End: Original strand, 15593324 - 15593380
Alignment:
76 ccctaatagaggaaaccaggatgagtgatggcaagtgacaacacttcattcttgctc 132  Q
    |||| ||||||||||||| | |||||||| |||||||||||||||||||||||||||    
15593324 ccctgatagaggaaaccacggtgagtgattgcaagtgacaacacttcattcttgctc 15593380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 55
Target Start/End: Original strand, 15593256 - 15593299
Alignment:
12 atgaagtggaatggaactgatgaggatggtgtggtggcttgttc 55  Q
    |||||||||||||||||| | |||||||||||||||||||||||    
15593256 atgaagtggaatggaactaacgaggatggtgtggtggcttgttc 15593299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University