View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_low_24 (Length: 249)
Name: NF1883_low_24
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883_low_24 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 140 - 249
Target Start/End: Original strand, 15593484 - 15593592
Alignment:
| Q |
140 |
tgctagtatattgggatttacaggctttgtagttgcttgaattggaaacttatagtctgccgcattgataggaaagttgattaatcaagacctatgtagc |
239 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| |||||||||||| |||||||||| || ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15593484 |
tgctagtaagttggaatttacaggctttgtagttacttgaattggaa-cttatagtctcccacattgataggaaagttgatgaatcaagacctatgtagc |
15593582 |
T |
|
| Q |
240 |
actgacacga |
249 |
Q |
| |
|
|||||||||| |
|
|
| T |
15593583 |
actgacacga |
15593592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 132
Target Start/End: Original strand, 15593324 - 15593380
Alignment:
| Q |
76 |
ccctaatagaggaaaccaggatgagtgatggcaagtgacaacacttcattcttgctc |
132 |
Q |
| |
|
|||| ||||||||||||| | |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15593324 |
ccctgatagaggaaaccacggtgagtgattgcaagtgacaacacttcattcttgctc |
15593380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 55
Target Start/End: Original strand, 15593256 - 15593299
Alignment:
| Q |
12 |
atgaagtggaatggaactgatgaggatggtgtggtggcttgttc |
55 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
15593256 |
atgaagtggaatggaactaacgaggatggtgtggtggcttgttc |
15593299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University