View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883_low_29 (Length: 242)

Name: NF1883_low_29
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883_low_29
NF1883_low_29
[»] chr4 (1 HSPs)
chr4 (85-227)||(4972964-4973096)


Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 85 - 227
Target Start/End: Original strand, 4972964 - 4973096
Alignment:
85 gtgattgcagtttgtaaaattgatgtgagaggtacggcaagtgactttattcattacctaaagcagtgcaacgagggatagggagggatagggtgaagta 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||    
4972964 gtgattgcagtttgtaaaattgatgtgagaggtacggcaagtgactttattcattacctaaagcagtgcaac----------gagggatagggtgaagta 4973053  T
185 gaagggaaatgacgcccagacatttaacatggccctaggaagg 227  Q
    ||||||||||||||||||||||||||||||||||||| |||||    
4973054 gaagggaaatgacgcccagacatttaacatggccctatgaagg 4973096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University