View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_low_31 (Length: 232)
Name: NF1883_low_31
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 43221838 - 43221621
Alignment:
| Q |
1 |
caagtgataaaaagacttggaggaaatttcaaagtccnnnnnnnctcacaacaacattgacagaactacttccagagccagcatcaacaactcgttcgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43221838 |
caagtgataaaaagacttggaggaaatttcaaagtccaaaaaaactcacaacaacattgacagaactacttccagagccagcatcaacaactcgttcgtt |
43221739 |
T |
 |
| Q |
101 |
gatcactgcttccatttgaacaacacacgttacagtgaagatgaaaaagacaaagagaatcagtgttggctttgagagtctcattttattgtacctgctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43221738 |
gatcactgcttccatttgaacaacacacgttacagtgaagatgaaaaagacaaagagaatcagtgttggctttgagagtctcattttattgtacctgctc |
43221639 |
T |
 |
| Q |
201 |
agaaattaactttaaaac |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43221638 |
agaaattaactttaaaac |
43221621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University