View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_low_32 (Length: 227)
Name: NF1883_low_32
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 47826390 - 47826195
Alignment:
| Q |
14 |
aaagagtgaaattaagacagggttttagagcaatgatgtggaagactatagagatgtgatg-----aaaataatagccagctagggttgcatatttataa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47826390 |
aaagagtgaaattaagacagggttttagagcaatgatgtggaagactatagagatgtgatgtgatgaaaataatagccagctagggttgcatatttataa |
47826291 |
T |
 |
| Q |
109 |
gggtgaatgctgtaggagacacgaacccgacaatttgacatttatcaagaccgaatcatgttgcacttaaagataatagaaagcattgaattattc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47826290 |
gggtgaatgctgtaggagacacgaacccgacaatgtgacatttatcaagaccaaatcatgttgcacttaaagataatagaaagcattgaattattc |
47826195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University