View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_low_33 (Length: 227)
Name: NF1883_low_33
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1883_low_33 |
| |
|
[»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 43222128 - 43221897
Alignment:
Q |
1 |
taaaatacatcatcattcagtagaggaa-----atagtaaggaataaattacttcataatacatgcaagcagtgtgtttgatctagggtaacactgagtt |
95 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
43222128 |
taaaatacatcatcattcagtagaggaattgaaatagtaaggaataaattacttcataatacatgcaagcagtgtgtttcatctagggtaacactgagtt |
43222029 |
T |
|
Q |
96 |
ggtgtagatatagtcttcactctccaaatcgttatcttcattaccaccatttacttgcttgcactcaacgccttgtttttcacattcacctcttctctgc |
195 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43222028 |
ggtgtagatatagtcttcactctccaaatcgttatcttcattaccaccatttacttgcttgcactcaacgccttgtttttcacattcacctcttctctgc |
43221929 |
T |
|
Q |
196 |
atagtaaaataaccagttactctaaaaaataa |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
43221928 |
atagtaaaataaccagttactctaaaaaataa |
43221897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11469 times since January 2019
Visitors: 6122