View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883_low_9 (Length: 380)
Name: NF1883_low_9
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 18 - 369
Target Start/End: Complemental strand, 11401719 - 11401368
Alignment:
| Q |
18 |
gaagagacggttcagatattttaataaagatagtcttgcatgtaagcaagatacatgcttgatggctaagtttcttacaagtaaagataaaacaaacggt |
117 |
Q |
| |
|
|||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11401719 |
gaagaggcgtttcagataatttaataaagatagtcttgcatgtaagcaagatacatgcttgatggctaagtttcttacaagtaaagataaaacaaacggt |
11401620 |
T |
|
| Q |
118 |
gctccttatcttcaagtggtccagtagtatcatcatttcttaatggtgaagacttgtcttctagaatgcttctaaaatcttctagtttatgcttgattta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11401619 |
gctccttatcttcaagtggtccagtagtatcatcatttcttaatggtgaagacttgtcttctggaatgcttctaaaatcttctagtttatgcttgattta |
11401520 |
T |
|
| Q |
218 |
attttcttacagttgtcatttgtcattgttgatattgtttgtgtgacctgtcttgacataatattttgcaattaactgaaatttcttttgcacacgttgg |
317 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11401519 |
attttcttacggttgtcatttgtcattgtttatattgtttgtgtgacctgtcttgacataatattttaaaattaactgaaatttcttttgcacacgttgg |
11401420 |
T |
|
| Q |
318 |
tgttgactaattgtgtatttcataaaattccatcagaacatcaaggtttctt |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
11401419 |
tgttgactaattgtgtatttcataaaattccatcaaagcatcaaggtttctt |
11401368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University