View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18841_low_10 (Length: 239)
Name: NF18841_low_10
Description: NF18841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18841_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 3119758 - 3119974
Alignment:
| Q |
1 |
tactggattaaaaacatgaataatgaattcatctatttgttagaagactaaccagtgatggagagaaaagtagaaaaaatatgcaaagaaaagacatagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3119758 |
tactggattaaaaacatgaataatgaattcatctatttgttagaagactaaccagggatggagagaaaagtagaaaaaatatgcaaagaaaagacatagt |
3119857 |
T |
 |
| Q |
101 |
attattactttgataattttgaatatggaaaatgcttattgttacaagagaaatgtttgacaagaaatgcaaaaatcatgtgtggcatcatatatatcac |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3119858 |
att---actttgataattttgaatatggaaaatgcttattgttacaagagaaatgtttgacaagaaatgcaaaaatcatgtgtggcatcatatatatcac |
3119954 |
T |
 |
| Q |
201 |
ttacaaatcacccactctct |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3119955 |
ttacaaatcacccactctct |
3119974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University