View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18841_low_2 (Length: 500)
Name: NF18841_low_2
Description: NF18841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18841_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 2e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 42858083 - 42858241
Alignment:
| Q |
1 |
aactgttaatctgattgaaagtttgaaacattgctgactcgagcatgatagaattcattctatcggataatgtcaaaattgtctctaacaaatagtcatt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| ||| || ||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42858083 |
aactgttaatctgattgagagtttgagacattactggctgtagcatgatagaattcattccatcacataatgtcaaaattgtctctaacaaatagtcatt |
42858182 |
T |
 |
| Q |
101 |
aatttcaggcaaagtattctatgttgagtgtc-actaatatatcatccacttggagtgt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
42858183 |
aatttcaggcaaagtattctatgttgagtgtctgctaatatatcatccacttgaagtgt |
42858241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University