View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18842_low_12 (Length: 250)
Name: NF18842_low_12
Description: NF18842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18842_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 202
Target Start/End: Original strand, 1695513 - 1695702
Alignment:
| Q |
13 |
aatatgaaattatttgcaactttattgtcttgttaacatgctaacccatttggtttggtctgacgatattgacttggaatcttggagtctctcattagat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1695513 |
aatatgaaattatttgcaactttattgtcttgttaacatgctaacccatttggattggtctgatgatattgacttgggatcttggagtctctcattagat |
1695612 |
T |
 |
| Q |
113 |
gagatatggttgaacatgtgtttatatttgacagtaatcctaatattaaaagtcaattttatatgattgagttagatccaacacaaactc |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1695613 |
gagatatgattgaacatgtgtttatatttgacagtaatcctaatattaaaagtcaattttatatgattgagttagatccaacacagactc |
1695702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University