View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18842_low_16 (Length: 233)
Name: NF18842_low_16
Description: NF18842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18842_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 5 - 220
Target Start/End: Complemental strand, 41785124 - 41784909
Alignment:
| Q |
5 |
attgaagctccattttcatcgctatcgttttcctttaaaaaatttgatatctcttcacctctttgtatcattgctgctttcagttcatggtttctatcct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785124 |
attgaagctccattttcatcgctatcgttttcctttaaaaaatttgatatctcttcacctctttgtatcattgctgctttcagttcatggtttctatcct |
41785025 |
T |
|
| Q |
105 |
gcagggccttattttcattcatcagttgtttaatctcataatttgtatctcttaactgctcttccaactcatttctctgattgatttgagtttccaattc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785024 |
gcagggccttattttcattcatcagttgtttaatctcataatttgtatctcttaactgctcttccaactcatttctctgattgatttgagtttccaattc |
41784925 |
T |
|
| Q |
205 |
gagttccatgttcttt |
220 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41784924 |
gagttccatgttcttt |
41784909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University