View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18842_low_9 (Length: 295)
Name: NF18842_low_9
Description: NF18842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18842_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 234
Target Start/End: Complemental strand, 45363018 - 45362797
Alignment:
| Q |
13 |
aatatggaaatagacttttctatgataacaggcatttcaatattccacctgaatgaaatgagtgaccaagttaggccgataatgctcgaatatgtgtttg |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45363018 |
aatatggaaatagactttgctatgataacaggcatttcaatattccacctgaatgaaatgagtgaccaagttaggccgataatgctcgaatatgtgtttg |
45362919 |
T |
 |
| Q |
113 |
ggtttctgataagttttctccaaaccattatcaatatcagcctcgtcattatacttgctggtggcatcgtttttgctccaccttcctcccctctcttgtg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45362918 |
ggtttctgataagttttctccaaaccattatcaatatcagcctcgtcattatacttgctggtggcatcgtttttgccccaccttcctcccctctcttgtg |
45362819 |
T |
 |
| Q |
213 |
ctcatcctcaccctccactgac |
234 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45362818 |
ctcatcctcaccctccactgac |
45362797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 59 - 179
Target Start/End: Complemental strand, 25040338 - 25040218
Alignment:
| Q |
59 |
acctgaatgaaatgagtgaccaagttaggccgataatgctcgaatatgtgtttgggtttctgataagttttctccaaaccattatcaatatcagcctcgt |
158 |
Q |
| |
|
|||||||||||| | |||||||| || || || | ||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| ||||| || |
|
|
| T |
25040338 |
acctgaatgaaaccaaagaccaagtgagaccaattaagctagaataagtgtttggatttctgataagttttctccaaaccataatcaatataagccttgt |
25040239 |
T |
 |
| Q |
159 |
cattatacttgctggtggcat |
179 |
Q |
| |
|
||| | ||| ||||||||||| |
|
|
| T |
25040238 |
catcacactagctggtggcat |
25040218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University