View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18844_high_12 (Length: 270)

Name: NF18844_high_12
Description: NF18844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18844_high_12
NF18844_high_12
[»] chr1 (2 HSPs)
chr1 (191-253)||(31853819-31853881)
chr1 (14-65)||(31854008-31854059)


Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 191 - 253
Target Start/End: Complemental strand, 31853881 - 31853819
Alignment:
191 gtattgagaggatcatataattcccacaatgggtacgaaacatttttccaaatataaatatag 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31853881 gtattgagaggatcatataattcccacaatgggtacgaaacatttttccaaatataaatatag 31853819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 14 - 65
Target Start/End: Complemental strand, 31854059 - 31854008
Alignment:
14 aatatatacatacaatggtggatttagatctctcaagtttgaaagaacttga 65  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||    
31854059 aatatatacatacaatggtggatttagatctctcaactttgaaagaacttga 31854008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University