View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18844_high_9 (Length: 350)
Name: NF18844_high_9
Description: NF18844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18844_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 1 - 348
Target Start/End: Original strand, 49044481 - 49044828
Alignment:
| Q |
1 |
ccacattctaattatggtttagcttgatccaaagggaaatatcctattccctactacataacctaccgcaaacataactttcaaatttcaatccatagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49044481 |
ccacattctaattatggtttagcttgatccaaagggaaatatcctattccctactacataacctaccgcaaacataactttcaaatttcaatccatagat |
49044580 |
T |
 |
| Q |
101 |
gcaggaagagcccctcaaattatagaatagaatggggatttcttacagttggtgaattaagctgaatgaataatataacaacatgtgaattacatgttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49044581 |
gcaggaagagcccctcaaattatagaatagaatggggatttcttaccgttggtgaattaagctgaatgaatactataacaacatgtgaattacatgttgt |
49044680 |
T |
 |
| Q |
201 |
aggaattaggatgtagctcaccgacctcgttcaacagttctcaattttttactaatttagttgaccacaaggattcatttattcagagtcattggtcaac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49044681 |
aggaattaggatgtagctcaccgacctcgttcaacagttctcaattttttactaatttagttgaccacaaggattcatttattcagagtcattggtcaac |
49044780 |
T |
 |
| Q |
301 |
agaatgtgaaattaatggcacaattcattaattgggtatgctacccta |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49044781 |
agaatgtgaaattaatggcacaattcattaattgggtatgctacccta |
49044828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University