View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18844_low_10 (Length: 344)
Name: NF18844_low_10
Description: NF18844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18844_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 11 - 193
Target Start/End: Original strand, 45945767 - 45945949
Alignment:
| Q |
11 |
caaagggtacatggttttggtttttctcaatcctttggctaaaccaacaacacctttgatgtaatcagcgtttccagcaaggaaagtcacaaaggcacag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45945767 |
caaagggtacatggttttggtttttctcaatcctttggctaaaccaacaacacctttgatgtaatcagcgtttccagcaaggaaagtcacaaaggcacgg |
45945866 |
T |
 |
| Q |
111 |
cctttaccaccgtcgagttttggtttctcaacggtagcattgacggcggtggtggtgattgcaggtgccatgatgaaggaagg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45945867 |
cctttaccaccgtcgagttttggtttctcaacggtagcattcacggcggtggtggtgattgcaggtgccatgatgaaggaagg |
45945949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 201 - 329
Target Start/End: Original strand, 45946014 - 45946142
Alignment:
| Q |
201 |
gagtgtgagaaattgtatgggtggagagctgcttaaatagaaattttttgctattttaatctgacggttgcaaagcgcttttaggaatctacggttgtta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45946014 |
gagtgtgagaaattgtatgggtggagagctgcttaaatagaaattttttgctattttaatctgacggtttcaaagcgcttttaggaatctacggttgtta |
45946113 |
T |
 |
| Q |
301 |
atgacatttcattaaataatcaagtaatt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45946114 |
atgacatttcattaaataatcaagtaatt |
45946142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 106
Target Start/End: Complemental strand, 55221397 - 55221333
Alignment:
| Q |
42 |
cctttggctaaaccaacaacacctttgatgtaatcagcgtttccagcaaggaaagtcacaaaggc |
106 |
Q |
| |
|
||||||||||||||||| |||||||||| || ||| | |||||| ||||||| ||||||||||| |
|
|
| T |
55221397 |
cctttggctaaaccaaccacacctttgacatagtcaccatttccaacaaggaaggtcacaaaggc |
55221333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University