View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18845_high_12 (Length: 292)

Name: NF18845_high_12
Description: NF18845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18845_high_12
NF18845_high_12
[»] chr6 (1 HSPs)
chr6 (8-183)||(8131323-8131498)


Alignment Details
Target: chr6 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 8 - 183
Target Start/End: Complemental strand, 8131498 - 8131323
Alignment:
8 gagagacttcttttgatccataatgaacttcttcaaaaccttagatatgtagtccttttggttgatgaataaggttatcttggatttataccttgtgata 107  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||     
8131498 gagagacttcttttgatccataatgaacttcttcaaaaccttatatatgtagtccttttggttgatgaataaggttatcttggatttataccttgtgatc 8131399  T
108 tgcataaccataatctttttagcaccccacatattcttcatttcaatctaactctcaagattcatctttaccttct 183  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
8131398 tgcataaccataatctttttagcaccccacgtattcttcatttcaatctaactctcaagattcatctttaccttct 8131323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University