View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18845_high_17 (Length: 244)
Name: NF18845_high_17
Description: NF18845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18845_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 10551072 - 10551290
Alignment:
| Q |
19 |
gatctatccatagaagaaaaatcacaaattttataaatttagatatggaaatgttgtcataagatttagtcgtacgaattccttaaaatgaatcaataag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10551072 |
gatctatccatagaagaaaaatcacaaattttataaatttagatatggaaatgttgtcataagatttagtcgtacgaattccttaaaatgaatcaataag |
10551171 |
T |
 |
| Q |
119 |
aatctaaattaaatattggttaataccaaattatcttgcctggtgtgcaggttgtcctgtcctggatagagagttgatattttcaccccaagagatttta |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||| || |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10551172 |
aatctaaattaaatattagttaataccaaattatcttgcctagtgtgaagcttgttctgtcctggatagagagttgatattttcaccccaagagatttta |
10551271 |
T |
 |
| Q |
219 |
cttggattttcctatgctt |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10551272 |
cttggattttcctatgctt |
10551290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University