View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18845_low_22 (Length: 202)
Name: NF18845_low_22
Description: NF18845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18845_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 58 - 185
Target Start/End: Original strand, 3237241 - 3237369
Alignment:
| Q |
58 |
ccctaaatttaatatagtcaaatcccctttgttggttaaaa-aagttttagtctcttacttggtccactaaaaagggtattaaagtgtaaaacatgagct |
156 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3237241 |
ccctaaatttaatatagtcaaatccactttgttggttaaaaaaagttttagtctcttacttggtccactaaaaagggtattaaagtgtaaaacatgagct |
3237340 |
T |
 |
| Q |
157 |
agtagattcccttcctgatgagtaagttt |
185 |
Q |
| |
|
|||||||||||||||| ||||| |||||| |
|
|
| T |
3237341 |
agtagattcccttcctaatgagaaagttt |
3237369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 3237168 - 3237212
Alignment:
| Q |
15 |
tttctcagaaagcgaaatattctatccaactataacaccccaacc |
59 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
3237168 |
tttctcagaaaatggaatattctatccaactataacaccccaacc |
3237212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University