View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18846_low_17 (Length: 256)
Name: NF18846_low_17
Description: NF18846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18846_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 40296758 - 40296997
Alignment:
| Q |
1 |
acttaagtaatagggttttggtgcctctcaagtctcaaccatgtgaacatggtgatttgccctaattgtgtgattgtggagacaacaaccctaagcaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40296758 |
acttaagtaatagggttttggtgcctctcaagtctcaaccatgtgaacatggtgatttgccctaattgtgtgattgtggagacaacaaccctaagcaatt |
40296857 |
T |
 |
| Q |
101 |
tgggaatgttcatgtcaagtcaatatgtacaaatattttgaatgttaagttttttgtggacaagaagaaagaaaagtgtaaat-aaaagttactctaggg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40296858 |
tgggaatgttcatgtcaagtcaatatgtacaaatattttgaatgttaagttttttgtggaaaagaagaaagaaaagtgtaaataaaaagttactctaggg |
40296957 |
T |
 |
| Q |
200 |
caagaaaataaagatttcaagaatgctagtagtaaaaact |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40296958 |
caagaaaataaagatttcaagaatgctagtagtaaaaact |
40296997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University