View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18847_low_21 (Length: 316)
Name: NF18847_low_21
Description: NF18847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18847_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 22 - 227
Target Start/End: Original strand, 331043 - 331252
Alignment:
| Q |
22 |
gaccggtggttgttgctgattgtattgactcattggtggcgatgatggctgttattgtgggtgggtggatggtgataactaattaataatggggtggtgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
331043 |
gaccggtggttgttgctgattgtattgactcattggtggcgatgatggctgttattgtgggtgggtggatggtgataactaattaataatggggtggtgg |
331142 |
T |
 |
| Q |
122 |
aagatgaatga----atgaatgaacgagtggtgtgtgatgtgatgtgatacagaacaaacacaactcaaatcctcatcatcacacgtcattactaactta |
217 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
331143 |
aagatgaatgaatgtatgaacgaacgagtggtgtgtgatgtgatgtggtacataacaaacacaactcaaatcctcatcatcacacgtcactactaactta |
331242 |
T |
 |
| Q |
218 |
ttccaaatca |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
331243 |
ttccaaatca |
331252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University