View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18847_low_21 (Length: 316)

Name: NF18847_low_21
Description: NF18847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18847_low_21
NF18847_low_21
[»] chr5 (1 HSPs)
chr5 (22-227)||(331043-331252)


Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 22 - 227
Target Start/End: Original strand, 331043 - 331252
Alignment:
22 gaccggtggttgttgctgattgtattgactcattggtggcgatgatggctgttattgtgggtgggtggatggtgataactaattaataatggggtggtgg 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
331043 gaccggtggttgttgctgattgtattgactcattggtggcgatgatggctgttattgtgggtgggtggatggtgataactaattaataatggggtggtgg 331142  T
122 aagatgaatga----atgaatgaacgagtggtgtgtgatgtgatgtgatacagaacaaacacaactcaaatcctcatcatcacacgtcattactaactta 217  Q
    |||||||||||    ||||| |||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||    
331143 aagatgaatgaatgtatgaacgaacgagtggtgtgtgatgtgatgtggtacataacaaacacaactcaaatcctcatcatcacacgtcactactaactta 331242  T
218 ttccaaatca 227  Q
    ||||||||||    
331243 ttccaaatca 331252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University