View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18847_low_22 (Length: 313)
Name: NF18847_low_22
Description: NF18847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18847_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 308
Target Start/End: Original strand, 14926250 - 14926539
Alignment:
| Q |
19 |
aaaggatccaaagtataaaatcacttggggaagtgacataatgattcaaatatttgtaatgcaagcttttgtatatgacgaggagttacttactgaacac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14926250 |
aaaggatccaaagtataaaatcacttggggaagtgacataatgattcaaatatttgtaatgcaagcttttgtatatgacgaggagttacttactgaacac |
14926349 |
T |
 |
| Q |
119 |
aataatgaaatgtgaattggggttnnnnnnngtgtccaaataaaatccatcaccccccattgttttgcgtgaaaaagtttacacaaatttagcattcaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14926350 |
aataatgaaatgtgaattggggttaaaaaaagtgtccaaataaaatccatcaccccccattgttttgcgtgaaaaagtttacacaaatttagcattcaaa |
14926449 |
T |
 |
| Q |
219 |
gttgtgtttgaagggtcaatatccttcttcctcaattacccaaaatatcctcctcactttccctaaacttgcatagtatcctttgcttct |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14926450 |
gttgtgtttgaagggtcaatatccttcttcctcaattacccaaaatatcctcctcactttccctaaacttgcatagtatcctttgtttct |
14926539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University