View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18847_low_41 (Length: 218)
Name: NF18847_low_41
Description: NF18847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18847_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 52369421 - 52369227
Alignment:
| Q |
1 |
ggggtgtctgttactgatttgtcaaataatgggtccaataagatgagtacttcaagcaggttgagtgattgcagacctcaacacatgattcttgaaagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52369421 |
ggggtgtctgttactgatttgtcaaat---gggtccaataagatgagtacttcaagcaggttgagtgattgcagacctcaacatatgattcttgaaagaa |
52369325 |
T |
 |
| Q |
101 |
accattcatttgttcaagataaagaacaaaacatggattcatccaaaagtgatcaattgaaacataaacaagttccagtgatttctctgcctgaagca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52369324 |
accattcatttgttcaagataaagaacagaacatggattcaaccaaaagtgatcaattgaaacataaacaagttccattgatttctctgcctgaagca |
52369227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University