View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18847_low_42 (Length: 211)
Name: NF18847_low_42
Description: NF18847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18847_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 21 - 109
Target Start/End: Original strand, 45389889 - 45389977
Alignment:
| Q |
21 |
tatgcttgatagtaagcagctgggtatgcaggatatccaatttctgggtatgcatacaaattcatggatggattatagtagtattgata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45389889 |
tatgcttgatagtaagcagctgggtatgcaggatatccaatttctgggtatgcatacaaattcatggatggattatagtagtattgata |
45389977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 54 - 109
Target Start/End: Complemental strand, 31559343 - 31559288
Alignment:
| Q |
54 |
tatccaatttctgggtatgcatacaaattcatggatggattatagtagtattgata |
109 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||| |||||||||| |
|
|
| T |
31559343 |
tatccaatttctgggtatgcatataaatccatggatggattataggagtattgata |
31559288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 60 - 109
Target Start/End: Complemental strand, 41610845 - 41610796
Alignment:
| Q |
60 |
atttctgggtatgcatacaaattcatggatggattatagtagtattgata |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||| |||||| |
|
|
| T |
41610845 |
atttctgggtatgcatataaattcatggatgaattatagtagttttgata |
41610796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 54 - 101
Target Start/End: Complemental strand, 15632818 - 15632771
Alignment:
| Q |
54 |
tatccaatttctgggtatgcatacaaattcatggatggattatagtag |
101 |
Q |
| |
|
||||||||||||||||| ||||| |||| ||||||||||||||||||| |
|
|
| T |
15632818 |
tatccaatttctgggtaggcatataaatccatggatggattatagtag |
15632771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 60 - 109
Target Start/End: Original strand, 36255465 - 36255512
Alignment:
| Q |
60 |
atttctgggtatgcatacaaattcatggatggattatagtagtattgata |
109 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36255465 |
atttctgggtatgtata--aattcatggatggattatagtagtattgata |
36255512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 101
Target Start/End: Complemental strand, 15601520 - 15601473
Alignment:
| Q |
54 |
tatccaatttctgggtatgcatacaaattcatggatggattatagtag |
101 |
Q |
| |
|
|||| |||||||||||| ||||| |||| ||||||||||||||||||| |
|
|
| T |
15601520 |
tatctaatttctgggtaggcatataaatccatggatggattatagtag |
15601473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University