View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18847_low_9 (Length: 436)
Name: NF18847_low_9
Description: NF18847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18847_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 11 - 161
Target Start/End: Complemental strand, 4702550 - 4702400
Alignment:
| Q |
11 |
cagagactagtggtggtatataatgtaacacatattataatattcaatttaactttgattaatttgctctaacaaatcaaatgagagtataaggagtcac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702550 |
cagagactagtggtggtatataatgtaacacatattataatattcaatttaactttgattaatttgctctaacaaatcaaatgagagtataaggagtcac |
4702451 |
T |
|
| Q |
111 |
tgcgggaaagaaataaattgtagagattatatttcaatagaacaattataa |
161 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702450 |
tgcaggaaagaaataaattgtagagattatatttcaatagaacaattataa |
4702400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 265 - 417
Target Start/End: Complemental strand, 4702390 - 4702238
Alignment:
| Q |
265 |
ttcttaaccattcaatttattcggaagttccagccacagctagtatgtattgctgtcaaaagaatccgtcaacccctacctggtgtggggcagcaggcca |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702390 |
ttcttaaccattcaatttattcggaagttccagccacagctagtatgtattgctgtcaaaagaatccgtcaacccctacctggtgtggggcagcaggcca |
4702291 |
T |
|
| Q |
365 |
gagagcaaaacaggattaggccgcaaaatctctttgccagtctagtgccctgt |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
4702290 |
gagagcaaaacaggattaggccgcaaaatctctggtctagtctagtgccctgt |
4702238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 168 - 200
Target Start/End: Complemental strand, 4705709 - 4705677
Alignment:
| Q |
168 |
gactaaaataattatgaaaaaagttccaatatt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
4705709 |
gactaaaataattatggaaaaagttccaatatt |
4705677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University