View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18848_low_2 (Length: 504)
Name: NF18848_low_2
Description: NF18848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18848_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 252 - 494
Target Start/End: Complemental strand, 44955318 - 44955078
Alignment:
| Q |
252 |
ttccacttgtctcttaagttatatacacttaaaaaataaatataaatgtagtagagtatatagctatattttaatacaattaaacttttagtgcannnnn |
351 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44955318 |
ttccacttgtctcttaagttatatacgcttaaaaaataaatataaatgtagtagagtatatagctatagtttaatacaattaaacttttagtgcattttt |
44955219 |
T |
 |
| Q |
352 |
nnnnnnctatttttgaaaataagcgtccttaattaacgtacggttggttcatcagcttcttttaccaaaccaaccaactatgattaactagcttttctaa |
451 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44955218 |
tttt--ctatttttgaaaataagtgtccttaattaacgtacggtcggttcatcagcttcttttaccaaaccaaccaactatgattaactagcttttctaa |
44955121 |
T |
 |
| Q |
452 |
ccatagatgtttacctatccaactacataacaataaagtataa |
494 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44955120 |
ccatagatgtttacctatccaactacataacaataaagtataa |
44955078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University