View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18849_high_2 (Length: 405)
Name: NF18849_high_2
Description: NF18849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18849_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 10 - 399
Target Start/End: Original strand, 31641243 - 31641633
Alignment:
| Q |
10 |
catcatcatgttttgatgaggttggtgttggtggtattctacacccc-cgtgaatgttagcatatcctttacatccaaggagtcaccaccatttcctcca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641243 |
catcatcatgttttgatgaggttggtgttggtggtattctacaccccccgtgaatgttagcatatcctttacatccaaggagtcaccaccatttcctcca |
31641342 |
T |
 |
| Q |
109 |
ccgttggtaaggccaagaaagtccctagtgagaccatcgtcgttctttccggtgagacagcctctcatgttgttaatgtagtgatcaactgagtctagct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641343 |
ccgttggtaaggccaagaaagtccctagtgagaccatcgtcgttctttccggtgagacagcctctcatgttgttaatgtagtgatcaactgagtctagct |
31641442 |
T |
 |
| Q |
209 |
gagtcactgatccaaactggccaatgctgagctgagaagtttgatggtgactcattgttggttggcttcctgtgatggcggccgcaccgacggttgctgc |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641443 |
gagtcactgatccaaactggccaatgctgagctgagaggtttgatggtgactcattgttggttggcttcctgtgatggcggccgcaccgacggttgctgc |
31641542 |
T |
 |
| Q |
309 |
tttttggagaagtgcagttgctgagaggtgtggtgacatggcagcactggaagaaggttgttgtgtgctgacgtggaagggtgatgatgtc |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641543 |
tttttggagaagtgcagttgctgagaggtgtggtgacatggcagcagtggaagaaggttgttgtgtgctgacgtggaagggtgatgatgtc |
31641633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University