View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18849_low_10 (Length: 278)
Name: NF18849_low_10
Description: NF18849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18849_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 84 - 266
Target Start/End: Original strand, 16662657 - 16662838
Alignment:
| Q |
84 |
tcctgccattcatattattagatgggaccaccattttcatccctgagnnnnnnnnnnnnnatgggaccaatattattttcacattgattaatcagttt-a |
182 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16662657 |
tcctgccattcatattattagatggaaccaccattttcatccttgagtttttttttttta--gggaccaatattattttcacattgattaatcagtttca |
16662754 |
T |
 |
| Q |
183 |
tcgaaggaacatgttctaagaagagaggagaaagatattaggttaaaaacctttttattttaatctacttgtcagttcatctca |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16662755 |
tcgaaggaacatgttctaagaagagaggagaaagatattaggttaaaaacttttttattttaatctacttgtcagttcatctca |
16662838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University