View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18849_low_14 (Length: 248)
Name: NF18849_low_14
Description: NF18849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18849_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 188 - 242
Target Start/End: Complemental strand, 22049593 - 22049539
Alignment:
| Q |
188 |
catcataaaatatgatgaaaaatgatactgcactatacttacactaaatattctt |
242 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
22049593 |
catcataaaatatgatgaaaaaggatactgcactatacttagactaaatattctt |
22049539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 22049816 - 22049765
Alignment:
| Q |
18 |
gtaacaaatctcatgtcatcatcaattatatgtaatttgtttgctattataa |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22049816 |
gtaacaaatctcatgtcatcatcaattatatgtaatttgtttagtattataa |
22049765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 104
Target Start/End: Complemental strand, 22049724 - 22049691
Alignment:
| Q |
71 |
tttcttttgctattatcccacaacaacatgaatc |
104 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
22049724 |
tttcttttgctattatcccacaccaacatgaatc |
22049691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University