View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1884R-Insertion-7 (Length: 102)
Name: NF1884R-Insertion-7
Description: NF1884R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1884R-Insertion-7 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 7e-40; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 7e-40
Query Start/End: Original strand, 8 - 102
Target Start/End: Original strand, 54479481 - 54479574
Alignment:
| Q |
8 |
agtatctctgcaaacacaccaagaatcatgaatcaggtgccaagaatagagttctttatttaacttatcttggactcttgcaaacaacttgatca |
102 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54479481 |
agtatttctgcaaacacaccaagaatcatgaatcaggtgccaagaatagagttctttatttaacttatcttggactc-tgcaaacaacttgatca |
54479574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 101
Target Start/End: Complemental strand, 25044370 - 25044311
Alignment:
| Q |
41 |
caggtgccaagaatagagttctttatttaacttatcttggactcttgcaaacaacttgatc |
101 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
25044370 |
caggtgccaaaaatagggttctttatttaacttatcttgaact-atgcaaacaacttgatc |
25044311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 75
Target Start/End: Complemental strand, 25040630 - 25040598
Alignment:
| Q |
43 |
ggtgccaagaatagagttctttatttaacttat |
75 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
25040630 |
ggtgccaagaatagagttctttatttgacttat |
25040598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 5e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 5e-16
Query Start/End: Original strand, 43 - 101
Target Start/End: Complemental strand, 10124244 - 10124187
Alignment:
| Q |
43 |
ggtgccaagaatagagttctttatttaacttatcttggactcttgcaaacaacttgatc |
101 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
10124244 |
ggtgccaagaatagggttctttatttaacttatcttgaact-ttgcaaacaacttgatc |
10124187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 52 - 102
Target Start/End: Complemental strand, 28649836 - 28649787
Alignment:
| Q |
52 |
aatagagttctttatttaacttatcttggactcttgcaaacaacttgatca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||| |||||||||| |
|
|
| T |
28649836 |
aatagagttctttatttaacttatcttgaact-atgcaaataacttgatca |
28649787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 43 - 75
Target Start/End: Original strand, 21393212 - 21393244
Alignment:
| Q |
43 |
ggtgccaagaatagagttctttatttaacttat |
75 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
21393212 |
ggtgccaagaatagagttctttatttgacttat |
21393244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University