View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1884_high_3 (Length: 295)

Name: NF1884_high_3
Description: NF1884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1884_high_3
NF1884_high_3
[»] chr4 (11 HSPs)
chr4 (17-289)||(11192548-11192820)
chr4 (17-278)||(11189970-11190233)
chr4 (17-200)||(11179308-11179491)
chr4 (17-128)||(11166294-11166405)
chr4 (22-173)||(11160539-11160690)
chr4 (22-238)||(11197756-11197957)
chr4 (22-204)||(11174532-11174711)
chr4 (22-96)||(5646597-5646671)
chr4 (22-96)||(11182099-11182173)
chr4 (83-162)||(11240855-11240934)
chr4 (22-94)||(11932023-11932095)
[»] chr5 (3 HSPs)
chr5 (33-200)||(36686949-36687116)
chr5 (22-94)||(8991411-8991483)
chr5 (22-94)||(8981906-8981978)


Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 11)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 17 - 289
Target Start/End: Original strand, 11192548 - 11192820
Alignment:
17 atcagcatgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtcgttggcacactcgtcgtctatc 116  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||    
11192548 atcagcatgtttcttgcaatactcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtcgttggcacagtcatcgtctatc 11192647  T
117 aaaagcttgatcgtctgggattgcactgccaccacctcttctatttcaaaggtctcgccctcataactcttaaggatgatcttcttcgacgacgatgatg 216  Q
    ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
11192648 aaaagcttgatcgtctgggattgcattgccaccgcctcttctatttcaaaggtctcgccctcataactcttaaggatgatcttcttcgacgacaatgatg 11192747  T
217 ccatgtctttgaaaccttaaatttgtatctatctctgagtttgaaaaggataggcgtgagtgagtataatata 289  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||    
11192748 ccatgtctttgaaaccttaaatttgtatctatctctgagtttgaaaagaataggcgtgagtgagtattatata 11192820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 17 - 278
Target Start/End: Original strand, 11189970 - 11190233
Alignment:
17 atcagcatgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtcgttggcacactcgtcgtctatc 116  Q
    |||| |||||||||||||||| |||||||||||||||||||||||||  ||||||||||||||||||||| ||||||| |||||||||| |||| | |||    
11189970 atcaacatgtttcttgcaatactcaataaccatggccaagatcttgcctgttacgttcgaaatagggatttcagtgtcattggcacactggtcgccgatc 11190069  T
117 aaaagcttgatcgtctgggattgcactgccaccacctcttctatttcaaaggtctcgccctcataactcttaaggatgatcttcttcgacgacgatgatg 216  Q
    ||| ||||||||||||| ||||| ||||||||| ||||||| ||||||||||||||||| ||| ||||||| |||||||||||||||   || |||||||    
11190070 aaatgcttgatcgtctgcgattgaactgccaccgcctcttcgatttcaaaggtctcgccttcagaactcttcaggatgatcttcttcattgatgatgatg 11190169  T
217 ccatgtctttgaaaccttaaa--tttgtatctatctctgagtttgaaaaggataggcgtgagtg 278  Q
    |||||  || |||||| ||||  ||||| ||| ||||||||||||||||| |||||||||||||    
11190170 ccatgaattagaaaccctaaatttttgtgtctttctctgagtttgaaaagaataggcgtgagtg 11190233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 11179308 - 11179491
Alignment:
17 atcagcatgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtcgttggcacactcgtcgtctatc 116  Q
    |||| |||||||||||||||| ||||||||||| |||||||||||||  ||||| ||||  | ||||||||||||||||||||||||||| ||||| |||    
11179308 atcaacatgtttcttgcaatactcaataaccatagccaagatcttgccagttacattcgttaaagggattccagtgtcgttggcacactcctcgtcgatc 11179407  T
117 aaaagcttgatcgtctgggattgcactgccaccacctcttctatttcaaaggtctcgccctcataactcttaaggatgatcttc 200  Q
    ||| ||||||||||||||||||||| ||||||| ||| ||| |||| |||||||||||| ||| ||||||| | ||||||||||    
11179408 aaatgcttgatcgtctgggattgcattgccaccgccttttcgattttaaaggtctcgccatcagaactcttcaagatgatcttc 11179491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 17 - 128
Target Start/End: Original strand, 11166294 - 11166405
Alignment:
17 atcagcatgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtcgttggcacactcgtcgtctatc 116  Q
    |||| |||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||| ||||| |||| ||||||  |||    
11166294 atcaacatgtttcttgcaatactcaataaccatagccaagatcttgccggttacgttcgaaatagggattccaatgtggttggtacacccgtcgtggatc 11166393  T
117 aaaagcttgatc 128  Q
    ||| ||| ||||    
11166394 aaatgctcgatc 11166405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 22 - 173
Target Start/End: Complemental strand, 11160690 - 11160539
Alignment:
22 catgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtcgttggcacactcgtcgtctatcaaaag 121  Q
    |||| ||||||||||  ||||||||||| ||||||||||||| ||| ||||| | || |||||||||| |||||| |||||| | ||| || |||||| |    
11160690 catgcttcttgcaatgctcaataaccatagccaagatcttgccggtaacgtttggaagagggattccactgtcgtcggcacaattgtcatcgatcaaatg 11160591  T
122 cttgatcgtctgggattgcactgccaccacctcttctatttcaaaggtctcg 173  Q
    ||||||||| || ||||  | ||||||| ||| ||| ||||| |||||||||    
11160590 cttgatcgtttgagattctaatgccaccgccttttcaatttcgaaggtctcg 11160539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 22 - 238
Target Start/End: Original strand, 11197756 - 11197957
Alignment:
22 catgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtcgttggcacactcgtcgtctatcaaaag 121  Q
    |||||||||||||||| ||||||| ||| ||||||||||||   |||  ||||||||||| ||||||| | | ||||||||| || | ||  |||||| |    
11197756 catgtttcttgcaatactcaataaacatagccaagatcttgtcagttgtgttcgaaatagtgattccatttttgttggcacattcattgttgatcaaatg 11197855  T
122 cttgatcgtctgggattgcactgccaccacctcttctatttcaaaggtctcgccctcataactcttaaggatgatcttctt---cgacgacgatgatgcc 218  Q
    ||||||||||| ||||||||                  |||||||||||||||||||||||||||| ||||||||||||||    ||||| |||||||||    
11197856 cttgatcgtctaggattgca------------------tttcaaaggtctcgccctcataactcttcaggatgatcttctttgaggacgatgatgatgcc 11197937  T
219 atgtctttgaaaccttaaat 238  Q
    ||| |||||||||| |||||    
11197938 atgactttgaaaccgtaaat 11197957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 22 - 204
Target Start/End: Complemental strand, 11174711 - 11174532
Alignment:
22 catgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtcgttggcacactcgtcgtctatcaaaag 121  Q
    |||||||||||||||| || |||||| | |||||||||||||  ||||| |||| |||||||||||||||||||| ||   |  | || || |||||| |    
11174711 catgtttcttgcaatactcgataaccttagccaagatcttgccagttacattcggaatagggattccagtgtcgtcgg---aaacatcatcgatcaaatg 11174615  T
122 cttgatcgtctgggattgcactgccaccacctcttctatttcaaaggtctcgccctcataactcttaaggatgatcttcttcg 204  Q
    |||||| || || ||||  | ||||||  ||||||| || |||||||| || || ||||||||||| ||| ||||||||||||    
11174614 cttgatagtttgagattctaatgccactgcctcttcgatatcaaaggtttcaccgtcataactcttgagggtgatcttcttcg 11174532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 22 - 96
Target Start/End: Complemental strand, 5646671 - 5646597
Alignment:
22 catgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtcgt 96  Q
    |||||||||||||||| ||||| ||||| ||||  |||| |||||||||||| || |||||||||||||||||||    
5646671 catgtttcttgcaatactcaattaccatagccagaatctcgctggttacgtttgagatagggattccagtgtcgt 5646597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 22 - 96
Target Start/End: Complemental strand, 11182173 - 11182099
Alignment:
22 catgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtcgt 96  Q
    |||||||||||||||| || |||||| | |||||||||||||  ||||| |||| ||||||||||||||||||||    
11182173 catgtttcttgcaatactcgataaccttagccaagatcttgccagttacattcggaatagggattccagtgtcgt 11182099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 83 - 162
Target Start/End: Original strand, 11240855 - 11240934
Alignment:
83 gattccagtgtcgttggcacactcgtcgtctatcaaaagcttgatcgtctgggattgcactgccaccacctcttctattt 162  Q
    ||||||| |||||||| |||||||||| || |||||| ||||||| || ||||||| ||  |||||||||||||| ||||    
11240855 gattccaatgtcgttgacacactcgtcatcaatcaaatgcttgatagtatgggattccaaagccaccacctcttcaattt 11240934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 94
Target Start/End: Original strand, 11932023 - 11932095
Alignment:
22 catgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtc 94  Q
    |||| ||||||||||| ||||||||| | ||||||||| | | |||||| |  ||||||||||||| ||||||    
11932023 catgcttcttgcaatactcaataaccttcgccaagatcctcccggttacctcagaaatagggattctagtgtc 11932095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 33 - 200
Target Start/End: Original strand, 36686949 - 36687116
Alignment:
33 caatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtcgttggcacactcgtcgtctatcaaaagcttgatcgtct 132  Q
    ||||||||||||||| | |||||||| ||||| ||||| || |||| |||||||||| | | || | |||| || || || || ||||| |||||||| |    
36686949 caatattcaataacctttgccaagatgttgctagttacatttgaaagagggattccactatagtcgacacaatcatcctcgattaaaagtttgatcgttt 36687048  T
133 gggattgcactgccaccacctcttctatttcaaaggtctcgccctcataactcttaaggatgatcttc 200  Q
    | |||| || ||||||  |||| || |||||||||||||| || ||  ||||||| ||| ||||||||    
36687049 gtgattccaatgccactgcctcgtcgatttcaaaggtctccccgtcggaactcttcagggtgatcttc 36687116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 94
Target Start/End: Complemental strand, 8991483 - 8991411
Alignment:
22 catgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtc 94  Q
    |||| ||||||||||| ||||| ||| | ||||||||||||||||| ||||| | || |||||||||| ||||    
8991483 catgcttcttgcaatactcaatcaccttcgccaagatcttgctggtaacgttgggaagagggattccactgtc 8991411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 94
Target Start/End: Complemental strand, 8981978 - 8981906
Alignment:
22 catgtttcttgcaatattcaataaccatggccaagatcttgctggttacgttcgaaatagggattccagtgtc 94  Q
    |||| ||||||||||| ||||| ||| | ||||||||||| ||||| ||||| | || |||||||||| ||||    
8981978 catgcttcttgcaatactcaatcaccttcgccaagatcttactggtaacgttgggaagagggattccactgtc 8981906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University