View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18850_low_6 (Length: 358)
Name: NF18850_low_6
Description: NF18850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18850_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 121 - 350
Target Start/End: Original strand, 32604551 - 32604779
Alignment:
| Q |
121 |
cttggaagctttcatgtgatttgggatggagccttagatttctattcatagtgttgaaaacaataagagtaaaaaacaagatggctcagattgcacatac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32604551 |
cttggaagctttcatgtgatttgggatggagccttagatttctattcatagtgttgaaaacaataagagtaaaaaacaagatggctcaggttgcacatac |
32604650 |
T |
|
| Q |
221 |
gatagaaaatggaaggtcgaacgtacaatgatgttagcaaaatgtgtgacgagatttgacatgggttgaaaccaacattttcnnnnnnngtaaattccca |
320 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
32604651 |
catagaaaatggaaggtcgaacgcacaatgatgttagcaaaatgtgcgacgagatttgacatgggttgaaaccaaca-tttcaaaaaaagtaaattccca |
32604749 |
T |
|
| Q |
321 |
agacaaattaaacgacggcacgcgtctctg |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32604750 |
agacaaattaaacgacggcacgcgtctctg |
32604779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 21 - 60
Target Start/End: Original strand, 32604451 - 32604490
Alignment:
| Q |
21 |
aagggacaagattctaatagggcaacttattacgagggac |
60 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
32604451 |
aagggacaagatcctaataggccaacttattacgagggac |
32604490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University