View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18852_high_12 (Length: 398)
Name: NF18852_high_12
Description: NF18852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18852_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 18 - 396
Target Start/End: Original strand, 28530114 - 28530492
Alignment:
| Q |
18 |
atatgcacattcccatactcatcatgctcctccttatccatatccttacatttcttcacattccttcaactattcctcctatcctagatcaccaccacta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28530114 |
atatgcacattcccatactcatcatgctcctccttatccatatccttacatttcttcacattccttcaactattcctcctatcctagatcaccaccacta |
28530213 |
T |
|
| Q |
118 |
ccatcatcatcatcatccaattatactgccccatttgattatgcataccctccacctgcccctcttcatcaattagtaccctcagccccaccctcttatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28530214 |
ccatcatcatcatcatccaattatactgccccatttgattatgcataccctccacctgcccctcttcatcaattagtaccctcagccccaccctcttatc |
28530313 |
T |
|
| Q |
218 |
cttaccatgttcctccagggagtcatcatagtcctcctcaacattctctttcacactcacaccatgctagcttattacaacatggatcatcctctcatta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28530314 |
cttaccatgttcctccagggagtcatcatagtcctcctcaacattccctttcacactcacaccatgctagcttattacaacatggatcatcctctcatta |
28530413 |
T |
|
| Q |
318 |
ttataattattatcagcaaaatactcctcatgaagaccgtcctgatcttcattcgcgtcataatagcttctctgctcct |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28530414 |
ttataattattatcagcaaaatactcctcatgaagaccgtcctgatcttcattcgcgtcataatagcttctctggtcct |
28530492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University