View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18852_high_21 (Length: 319)
Name: NF18852_high_21
Description: NF18852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18852_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 122 - 309
Target Start/End: Original strand, 40472372 - 40472577
Alignment:
| Q |
122 |
agtgtgggtatgtatagatccttcatggatccttggcttggcatatttgaga------------------tttggttggtggaaattcttacaggaacat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40472372 |
agtgtgggtatgtatagatccttcatggatccttggcttggcatatttgagacttgagacttcattcagatttggttggtggaaattcttacaggaacat |
40472471 |
T |
|
| Q |
204 |
aaaggccagctaaactagtctttttgtaccttaattatcccacccaaaattgtatatcatcttacaaacctaaatactgcaaattgaatgtctttattct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40472472 |
aaaggccagctaaactagtctttttgtaccttaattatcccacccaaaattgtatatcatcttacaaacctaaatactgcaaattgaatgtctttattct |
40472571 |
T |
|
| Q |
304 |
cctatg |
309 |
Q |
| |
|
|||||| |
|
|
| T |
40472572 |
cctatg |
40472577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 49
Target Start/End: Original strand, 40472269 - 40472299
Alignment:
| Q |
19 |
gttcattgaacatgatgaaacataatctgtt |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40472269 |
gttcattgaacatgatgaaacataatctgtt |
40472299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University