View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18852_high_25 (Length: 267)
Name: NF18852_high_25
Description: NF18852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18852_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 88 - 198
Target Start/End: Original strand, 19974190 - 19974300
Alignment:
| Q |
88 |
atagtagcaatctatgatagttcccgaagtagcaattcctatttttgtttctaaacagtttgtaaataagggacttttctttctttcttttaaaaggaaa |
187 |
Q |
| |
|
|||||||| | |||||||||||||| |||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19974190 |
atagtagctagctatgatagttcccaaagtggcaattcctatttttgtttctaaaaagtgtgtaaataagggacttttctttctttcttttaaaaggaaa |
19974289 |
T |
 |
| Q |
188 |
aggcataaggt |
198 |
Q |
| |
|
||||||||||| |
|
|
| T |
19974290 |
aggcataaggt |
19974300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 16 - 63
Target Start/End: Original strand, 19973949 - 19973996
Alignment:
| Q |
16 |
atcaagaaattaaaatcaccaaagcaactgaaattcagaactagatga |
63 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19973949 |
atcaagaaactaaaatcaccaaagcaactgaaattcagaactagatga |
19973996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University