View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18852_high_27 (Length: 262)
Name: NF18852_high_27
Description: NF18852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18852_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 51 - 245
Target Start/End: Original strand, 41739481 - 41739675
Alignment:
| Q |
51 |
aaaattaagctcgattaatcaaatgttcaatcaagttcctaaacttgcattgacataaacaaggattcttgaatgcgacaatgaccggtacggtgcaagt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41739481 |
aaaattaagctcgattaatcaaatgttcaatcaagttcctaaacttgcattgacataaacaaggattcttgaatgcgacaatgaccggtacggtgcaagt |
41739580 |
T |
 |
| Q |
151 |
catggacaattcaacaagaattgctaccaacctttatttcttgaagaccaactcaagtctctcattgcttcaataatcttaacatggtagtataa |
245 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41739581 |
catgcacacttcaacaagaattgctaccaacctttatttcttgaagaccaactcaagtctctcattgcttcaataatcttaacatggtagtataa |
41739675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University