View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18852_low_19 (Length: 377)
Name: NF18852_low_19
Description: NF18852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18852_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 22 - 364
Target Start/End: Complemental strand, 30995272 - 30994930
Alignment:
| Q |
22 |
gtagctttgatggagtctagagtaattgtccttcatgtaacccttcattttggtctacaagtacttcacttggctcaatcacatgaaatgatgggaagtg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30995272 |
gtagctttgatggagtctagagtaattgtccttcatgtaacccttcattttggtctacaagtacttcacttggctcaatcacatgaaatgatgggaagtg |
30995173 |
T |
|
| Q |
122 |
gttatgcatggatagccactgattggctttctacgatactagattccgatccttcgttgtccacatctgcagcgatgaatgacatgcaaggtgttatcac |
221 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
30995172 |
gttatgtatggatagccactgattggctttctacgatactagattccgatccttcgttgtccacatctgcaacaatgaatgacatgcaaggtgttatcac |
30995073 |
T |
|
| Q |
222 |
cttgaggatgtacacaccagaatcaaaaaacaaaagaaatttcacttctagatggaacagaaacctgagccataacataggttctgatcatgaccataat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30995072 |
cttgaggatgtacacaccagaatcaaaaaataaaagaaatttcacttctagatggaacagaaacctgagccataacataggttctgatcatgaccataat |
30994973 |
T |
|
| Q |
322 |
catggtccttcttttggtttaaacatgtttggtttatacgcct |
364 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30994972 |
catgggccttcttttggtttaaacatgtttggtttatacgcct |
30994930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University