View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18852_low_23 (Length: 319)

Name: NF18852_low_23
Description: NF18852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18852_low_23
NF18852_low_23
[»] chr3 (2 HSPs)
chr3 (122-309)||(40472372-40472577)
chr3 (19-49)||(40472269-40472299)


Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 122 - 309
Target Start/End: Original strand, 40472372 - 40472577
Alignment:
122 agtgtgggtatgtatagatccttcatggatccttggcttggcatatttgaga------------------tttggttggtggaaattcttacaggaacat 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||                  ||||||||||||||||||||||||||||||    
40472372 agtgtgggtatgtatagatccttcatggatccttggcttggcatatttgagacttgagacttcattcagatttggttggtggaaattcttacaggaacat 40472471  T
204 aaaggccagctaaactagtctttttgtaccttaattatcccacccaaaattgtatatcatcttacaaacctaaatactgcaaattgaatgtctttattct 303  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40472472 aaaggccagctaaactagtctttttgtaccttaattatcccacccaaaattgtatatcatcttacaaacctaaatactgcaaattgaatgtctttattct 40472571  T
304 cctatg 309  Q
    ||||||    
40472572 cctatg 40472577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 49
Target Start/End: Original strand, 40472269 - 40472299
Alignment:
19 gttcattgaacatgatgaaacataatctgtt 49  Q
    |||||||||||||||||||||||||||||||    
40472269 gttcattgaacatgatgaaacataatctgtt 40472299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University