View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18852_low_27 (Length: 267)

Name: NF18852_low_27
Description: NF18852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18852_low_27
NF18852_low_27
[»] chr5 (2 HSPs)
chr5 (88-198)||(19974190-19974300)
chr5 (16-63)||(19973949-19973996)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 88 - 198
Target Start/End: Original strand, 19974190 - 19974300
Alignment:
88 atagtagcaatctatgatagttcccgaagtagcaattcctatttttgtttctaaacagtttgtaaataagggacttttctttctttcttttaaaaggaaa 187  Q
    |||||||| | |||||||||||||| |||| |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||    
19974190 atagtagctagctatgatagttcccaaagtggcaattcctatttttgtttctaaaaagtgtgtaaataagggacttttctttctttcttttaaaaggaaa 19974289  T
188 aggcataaggt 198  Q
    |||||||||||    
19974290 aggcataaggt 19974300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 16 - 63
Target Start/End: Original strand, 19973949 - 19973996
Alignment:
16 atcaagaaattaaaatcaccaaagcaactgaaattcagaactagatga 63  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||    
19973949 atcaagaaactaaaatcaccaaagcaactgaaattcagaactagatga 19973996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University